Description :
From Genome Similarity Track
Location :
contig_7:575788- 577891
Transcript NameFunction/comments
g2086.t1hypothetical protein

Sequence
2103 bases(100 bases per row)
CGACAAGACCGGGTTCGTGACGAGGCAAGGACTGTTCAGGTTCGTCCGGATGCCGTTCGGGTTAGCGAACGCGCCGGGCACCTTCCAAAGGATGATGGAT
GCGGTGCTCCGAGGACTTACGTGGGAGAGCTGTTTGGTATACTTAGACGACGTGATCGTGTTCTCAAAGGGTGATATGGCGCAGCACGTTGTAGAATTGG
CCATGGTGTTGGAACGGTTGGACCAGGCTGGCCTATCACTCAAGGCGGGTAAGTGCTCGTTTGCAAAAGAACGGCTAGAGTACTTAGGGCATGAGTTGGA
CGCGACGGGAGTACGACCGATGGACAGTCTGGTGGAAAGCGTGCGCAAGTTTCCGGCACCCACTGACACGACGGAGATCAAGCGATTCGTTCACATGGCT
GGTTACTACCGGAGATTCGTGCCGGGTTTTGCAAGCAAGGCGGCGCCATTGACCAGACTGCTAAGGAAAGATGCGGAGTGGCGCTGGGCAGAACCACAGC
GAAAGGCTTTTGAAAGTTTAAAGAGGCGTTGACGAGGCCGGTGTTGGCGTACCCGGACTTCTCACGGCCCTTCAAGTTAGTCACGGATGCGTCGAAGGTC
GGACTAGGCGCTACGTTGACACAGGACCAAGGTAGCGGAGAGCAACCTGTGGCTTACGCGTCGAAGTAAACTCGCCTAGCGGTAAAGTACAGTATTACGG
ACTTGGAGTGTGCAGCAGTAGTGTGGGCGGTGAAGCTCTTTAGGCCGTACCTCTACGGTCGCAAGTTCGAGCTGGTAACGGATCACGCAGCACTCAAGGT
TGATGACTCGAAGGACTTGTCGGGGCGTTTGCACCGCTGGGCATTACAGTTACAAGAGTACGACTTCGAAGTGGTGTACCGACCTGGGTCGAGCAACGTG
GTCGCAGACGCGTTGTCGCGAGCACCGATCCACACGGTGACAAGCCGCGAGGTCGGGCATCGAGAGAGAAGAGATAGCTGGAGATTTGCCGAGGCAAGGA
AGCGAGGACAGCTCACTGACGAGATGATTCGTGCACGGCAAGCGGATGACAAGACGGTGCGGAAGTTGCGCCGGGAGAAGAAGTACGGAGGGCGCGCAAT
TGTAGTGAAGGACGAGCTGTCCACATTCGAGAAAGCGACGGCAGTCTGCGAATAGTCTTGCCGACAGCGTTGTGGCCCGACGTGCTGCGCGAGAACCATG
ACTCTATCTTCGCGTGTCACCTCAGGGTACCGCAGACGTACGCCAGAATCGCTGCGCGATACTGGTGGCCCGACATGAGGACGCACATAAGACGGTGGGT
GCGTGCGTGCAGGGACTGTGGCACACGGAAGTCGAAGGCAAAGGAGGTGATACCTCCGCTACGTAGTCAAGGGATCGGTGATGTTGGCGATCGGTGGGCC
CTGGACGTGGCTGGCTCACTTCCGCTTACGAAGGACGGCAATCGGTATGTGGTGGCGGCCGTGGACTACGCTTCGAGATACGCTGTGGTGGCTGCAGTAC
CCAGCCACACAGCCAGGGACATCGCACACTTCATCATGGAAAAGGTCGTGTTGGTGTACGGGCCCGTCCGAGAGATCGTGATGGACGGCGCGCCGGAGTT
GAACGGAGCAGTAGTAGAAGCGCTGGTGAGTATGCTACAGGCCAAGCAAATCACACCAGTGCCGTATCGACCAGCTCTGCTAGGCTTGGTGGAGCGGTTT
CACCGCACCTGGAAGGACATGGTGGCGATCTACGTGTCGGAAGCGCAAGACGACTGGGACAGGTGGCTCTCGTGCGCAGCATACGCGTACAACGGCGCAA
AGCATTCCGGTACGGGGTTTAGCCCCAACGAGTTGATGATGGGGCGGCGCCTCCGGGCACCAAACGAGTTGTTGAGAAGCAGCGGAGTGACGCAGGTCGG
GGCATTCGCAGATTTTGAACGGGCACTCGTGAGCAACTTGGCACGGGCAACGACGGCAGCAAAGAAAGCTCTCGTCAAGGAGCAGCAGCGACGGGCGAGG
TACTACGACAGAAGGGTGCGTCAGAGTGTAGTCTTCGATGTAGGAGATCGCGTGTGGGTGCTGCGACCTCCGCGCGGCAAAGGAATCACAAAGCTGTCGC
ATC