Description :
From Genome Similarity Track
Location :
contig_19:575656- 577358
Transcript NameFunction/comments
g5255.t1XP_008900802.1 hypothetical protein PPTG_08459 [Phytophthora parasitica INRA-310

Sequence
1702 bases(100 bases per row)
TTGGCCGTCACGGGGTTCGCCAGCACCGTCTGGATCTGCGCCTCGATAAAGTAGCACCCGGGCTCCACCGTCAGCACCAGCACCATGTTCTTCTCCAAGT
TGCGCACACACCGGAGCTTGGCCAGGATCTTCTTCGTCGAGCGCGTGTAGCCCACGGGGATGCCGCCGACGTCGTGCGTGTCCAGGCCCATCAAGTGGCC
CAGGCCGTGCGGGTAGAAGAAGGCTGAGATCTCGTGGTCCATGAGCTCGTCCACGGTGCCGTTCTGGAACAGCCCGTACTCGAGCAGGGTGCTGCGTCAG
CACGCGGTGCGACAGCAAGTGCATGTCCACGTAGCTGATCCCAGGCTTGATGGCCGCCATCACCGCGTCGTGCGCCTTCAATACACCTTCGTAGACCATG
CGCTGGTCCGCCGAGAAGACGCCGTTCACAGGCCACGAACACGTGATGTCCGACGTGTAGCCGTGCAGCTCCCCGCCCATGTCATTCAGGAAGAGATCGC
CATCCTCCAGCAGCTTGTCGTTGGGTGCTCCCGCGTGGCCATAGTGAAGCGCCGACGCATTGTGGCCGCTGCCACAGATGCACGTGTACGCGTGGAAGCG
CGCGCCTCCGTTGCTGTACACATAGTGCAGGAAGTCGCTCTCGGCGTGGAACTCCATCTTGCCCGGCCGGATGTTCTTCATCACGTTGACGTGCGCGCGC
GACGACAGCTTGTTGACGAAGCGCAGCAGCTCCAGCTCCTTCTCCGTCTTGATCACGCGGCACTCGACCAGCACGGGGTGCAGCGTCTCCCTGTCCACCT
CAAACTGGTCGATGCCCTCGAATGTGGACGTGGTGGTGGTCTCCAGGCCGCTGTCCGCAAGCCTTGGACGAATATTGGAAGAACACTGTTCGTGGAACGA
AGTGGGGAGGTAAAAAACCTCAAGAATATTGTTCTCGAGGTTTTGGACCTTCGTCCGTAATATCGGTTTTTGCAGGGGAATATGCTGGCTGGCGTGTGCA
CTGCACAGTGGGATGTGTTCGCTTCTCGCCGGTCTGGTTGGCAGAAATGATTTTTTCTGCGATTGGCTATTAGTCAAACGGTAATTTATTAAGATCTTGG
AGAGGCGGGAGAATATTGCAGTCTTCCCGACGATGGTGCTAACTCGCGCTCAAGCTCGCGCTCAAGCTGCTGCTCGATCTCAAGCTGCTGCTCAGGACGA
TGTGGAGATCGACGGCGACATCGACGACGGGGAGATTCACGACGCCGCTGCTGACGGAGAGATCGGCGCCGCTGGTGATGACGCGAAGAAGGACGTGGAT
CGGTGTATCAACACTCTGCAGAGCAAGGAATCCCAGTCTGGTGACGACGCGGTGCGACACGAAGGTGGACCAGCCGAGCAGCCCGAAGCTTCCCAATACA
GCATTGAACACAGCTTGCAGTCAGCTGTTGATGCCATCTGCAAGACGATTAAGGAGGGTGTGCGTGAGCTGACGCCTGTAGACGAGCGCCAGAGAATCCG
AACGACACGCTACGAGCCCGACTGGAGCAACGACGGCGACAGTGGCAGCGACTCTGATGGAGATAGTGAATTCGAGATGAGGATGCTAGAGGCATGGGAG
AAATCCTACCGACACGCACCACGACCTGTCTCTCCTGTTCAACTGCCTAATAGAGAGAGTCGCCGTCCAAGCAATCTTGATGATGAGTCAAAGGTGCATG
CA