Description :
From Genome Similarity Track
Location :
Scaffold_473:5755- 25703
Transcript NameFunction/comments
g14368.t1hypothetical protein

Sequence
19948 bases(100 bases per row)
GCAGCTGAATCAATTGTTTCGGCCAGGTATGGCAAATATGAGCATGGGTATCATCCAGGTAAATGCTTCATCCACTTCTTCGACGGAGCGCTTTTTCCGC
CGGCGTGAAGACGACCCTCGATCCTGGGCTTCAGCCTTTTGCTCTTCCTCCTCCTCCTCGTCTTCCTCCGTGTCATGGGTGTTGGCTACTTTGTTCACGG
CATGCGGACCAAACAGCATAGCGCTGGCTTGTTCACGCTCCTCTCTTGCGCGTCACAGTGCGGCGGCTCTCTCAGACCGAGTGCGAGCCTTCTCTTCCCC
CCCCTGCTTCGGCTGCGGCTGCTGACAAGCGAGCCTCCTCCTCTAGGCGAGCCTCCTCCGCCATCGTGCTTGTCTTGCAGAGACGTTTGTGGATGCCGGC
CATAGCTGTGGCGGTACGCTTCGCGTCGGGCCCAACGCTGCGGTGGGACTGCACTGCCGATGATGCTGGAGGAGAAAGAAACTAAAAATTTTGGAAAAGA
GAACGGTAACTAATACCTGTCTGTATAAGCTGGTCGATAGGCGTGTGAAAAATATGGAGCGAGCGTTGTCTATATAATAAATTTTATAGACGAGGGCTAG
ATAACAGCCTTCGAATACAGTTTCGCGCCGTGTTCTGAACTATGAGGCAACTCTAATCATTTTCAGAAATGAGTTCGTTCATCTCGCGATCGATTGATTT
CACTCAAGCACTGACAATTTTGTCGTCATACGAGCCCCTTCCTCGCGGGCGCGTTGTTGTTTCGAACAGGAGTGTGTTTCTCTCGTCAATATGTAGTCTG
TGAGTCGTCCGTAGCGAGTGGTGAAGCAGATGAAAAGAGATCTTCGAAGGGAAATGGGACATTAGAATCGCAGTTGGATGGATAAGTATAGAGTCTTGGA
CAGTGAGGTTGACGGAGCGGAGGGAGGGCAAGACTGGGCGAGACGAGCGGGACAGGAAACGCACTTGAGGGTAGAATGAAGATTCGAGAAGATGATTGAT
TGAAGGTCTTAGTCGCTAGCCTTCCGGCCTACTCTAGACTACTGGATAACACTACTTGAGTTCTTACTGGATCCTGAGTTACTTCAGCCCATTGAGAGAG
GCCGTCGAAGCCATCTGTACCACAGGTGGGTAATCGAGTGGGTAGTCGTCGATGGTAATCGGCGTGGGTCGATTGGACGGTTGGTTGAACGGGTTATATC
GGTCAATCAAGATACTAAACGTACCTCAAGATCCCCTGCATAAATATACCATTCTTGCCCTACATAGCGATTTATAGATAGGCTTGGCTAGTGATTTCTA
TTTTTTCTTGTATTCTCTTTCAGTCTTTTCTTCACCCTCACGGTCCCGCTATAGGAAGCAGCAAGCGACGGGAAGCCCCCCCCCCCGCGGATCTTGACCC
GCATCAGGATCCGCCGGATGAAGACCCAATGGCGAAAGACAAAGGATGTTCATGCACCACCACTACATCCGCCTCCGTTGGAACGTCTAAGAAGAAAAAG
ATGGCTACGAGGGAGAAACTCAGAGCACCCGACTCTGAGGGCGAGGGTCGTGCTGTATTGAAGTCTACCTGGTCACGATCTAAGCCGGAGGTAGCATATC
GATCCACAGCGCTGCTCGATTTCATTCGCAAGAATCCAGCAGTGCGGGGCTCACAAACCAATCTACGTGGATCTCTCACCGGACCCGTACGAGCTCCAGT
GTTGACGACAAGCAAGTTAGACGCTACCATAGATCTACTACGGCTGGTGGAAGAAGATGGCATTACGACTGGAGCATTTGATGCCGACGACCTCTTCCGA
CTTGACAAGGATGCGACAAGAATCTCGGCTGCGTCACTGTTAAACCTACTGAGGAACCTGGTCGGTGAAATACCGGCGACTGAATGCAGGAACACATGTC
AACGGATACCGAGTCGATGGAAAATCAGACCGGACTGTCTTAATACGCTTCCGCTACATCGGAAGCCAGATCAGACAACTCGTATGAGCCATGGCGCATA
TCGCTGGATGCGTCCGGCGCGGCGATGCTTCACACTTGTCTACAGTCCCAAAGGAGGTAACGAGGCAAGAACACCGTGCAGGAATCAGTCGAATGTTCGA
ATCAGGCGGACCTCTCTTGTGGGACCACCTCAAGAATCTACAGGTCAGCTGTAGACTATCGAATAGGAACACGCAGAAAATCTCACTACCGAACGGTATG
AGTCCCACCAACAACACACGCTTCCCTCGCGAAAGATCAGCGAACGTTCGATCAACACCTGAAGACCTGGAGCGATCACTTACACCGGATTGGTTGCAAG
CACCTGAGGCGAGGCGGGTGAACGCCTTTATCGTCCAGGGTGTACAGTCGTGCCGGCAGACGAACGAGCTTCGAGAACTCAGACGACCCGAACGCTTCGG
GGAGTACCCGTTCCTCTAGGAGGGAGCGTCCGGATGCCGGGGTCAGAATCCCGAATGCAGACAACTAGTGTCTGCCCCGAGATTTGGCGTGTGACCTTGA
AGTAATCCCTATCGGTGTCGTTTATCTTCGACGGACCGGGCTTTGACTTTTGGGATGTTCTTCGATCAGGATACGTAGATATGTAGAGAGACTACCAGAC
TCTAACAGTCCGGAGTGTCTTGGCTGGGAGTGGGGTCACGAACAAAGACCTTCTCCAATATAACCAAAAGCAATACAGAAACAACAACAGAGTTTGTTAT
ACACTCACAATATACAGCCTGTCCGACTGAGTTACAGTCCCGAATACAGGTAAATTCGGGATGCCTCCGCGCACCACTCCCGGATGGGAGAAATATACAA
GTTCCTTCGAACCACACAGCAATCTACTATCAAAATCCAGGGGGGATTGCTAATAACCTCCCGAATCGTAGGTGAATATGAAATGAAAGCAGTCACTCTA
AAGCAACCACAGTCAACTGACAAATGAAATAGGCGGATCAATCCAGGGATACGAGTTCCTGGTCCCCACCTAAATGGGACTTAGACTTAGGTGAGAGTTT
TCGCACGGGTTCCTCGATCTTCGTGCGGTCTTGGTCGTCCGATACGCCAGCGCTCCCGGGCCGCAGCCTCGTAGTAGTCGCTATAGGTCGCAGCAGTCTT
CCTCAACGCAGTACGCTCAAAGCAAGGGGGCCGACAAGGCACCACTTCTCACTTCCAACGCAAAACAAACTCTGTTTTCTTCTTATCACTATCTTCTTCT
TCTGTCTGACTTGGTCTACTGGATTCTTGGCGGTCTCCTTCGTCGTATCCGCGCACTCGCATTCAGGTTGACTTGGTCTTAGTATGTGGGTTGCACGTCG
AACGTCACGTCGGGCTCTGGAGCGGAGCACACATCACATGTCGACGCTGATATCTTTGGGGTCCCTTCGACTCACTTGCGGTTTGTATGGGGATCTGCAG
CACGGCCCATCCCGACGGTGGGACCGGCATTGCGTTTCTCCGGGCACACCTCGAAACTGGCCCCTTGGCCAGCTGGTCGGACGCCGTGTCACTCGCTGAT
TGGCTGAGAGCCACGCAGCTTCAACTTCATCCGGGATGTCGATTCATTCGGGAAGTCACTTGATTATTCGGGATGTCCTCGTCGCTTCGGGATGTCCGTC
GCCAACTCGGGTTATCCGAGCTCTGCAGGCTCGGATCTCGCTTTCCTTCACGCCTTCGGAGGTATAGGCTTCTGTCATCTTGTGCCTTCATCACTCGGCT
CTCCTTCCAGGTTCATCGCTACACAGTCGTTCCAGGCTCGGACTTGGGTGGTTCATTCAGGATGTACGTACTCATCAGGGGCCTGTACGGGTCCAGGTTG
CTCGGCCTTGGCTGCAGTCTCTAGAAAGCCAGTCACTCGGGTGACGCACGTGGCTGTATCCCGGATCATCTTCTCTCCCACTTGATTCTGATGGGCACAG
ACCGGACGGCGCAGCTGCGAACGAGAAACTCAAGATCGCCTCGTGTCACACCTCTGCATACCAAGGTTGAGTTTGGTCAATCTCAAAACCTGTACTACTA
GCCACGAGCGAGGGCTATAATGCAATTTTGCGCTTTCACGCGAACCCCCGCAGTCCCTCAGAAGGAAGGGCACCGGTTATCACGCCTAATACGGGTTTGC
CGAAAGTAACCTCAGCGGGTACTGAAATATTGTCCTGGCCAACGAACCTTGGATGGATTTGGGCTACAGTAACGGTCTCTTCCTGTGACATAACTCAGAA
CGGTAGTTATATATAAGGGATAAAAACGGGCGCAGATTCCGAATTTGACATCTTTTTTTCCCATGTTTTGAGTCCTTTCCCTTCATTTAGGCTACTGACG
GGAGCTACTTTATCTTGCAATATTGTCTGCAGTTGCAGTCTGCCACGTAGGCGTTGTTCATTGTTGGAATTGGCTAGAACGAGAAAACAGCTGAAGATGT
ACAATCAGACCAAAACATACGCAGTATATTACCGCAGATCGTGATCGTTAAAAAGATGGGGTGCCTGTTAAAATAAATCTTCAAAGAGAATATATTTTGA
GTAACGAAAATCCGTAGAGTCACTTGCTTACTCTCAGTCGCTCTCCTCTCGAGAGTCGTTTTCGCTCTCATCTTCGCCCGACATGAGCTCGCACAGCTCC
CCGTCTCCAGCCACTTCGTGCTTTTGTGCATGCTCATACGCGTTAGTTCAGGTTTCTGAGACGAATGAAGCGAGGCCAGCGTCGATTTTGTGTCGCAGCT
CAGGCATGTCAGACGCTGGTTCGTCATCAACCTGGCCCTTGATGTGGGCCCAAATAAGCTCGATGGGTTGGAGCCCCGGGTGGTATGGTGGAGTATAGTA
CACCAAATGCCCACAGGATGTAACGATTTCTGTTGCTCTATAGATCGCTGTGGGCTTGTTAGCGCGCACCAGCGTTAACAGCTCCGCATTTGTGTAGTTT
GTGTCGTACCAGATTTCAAAAATTTGCAGTTATTAGTATCAACACATCAATAATATCAAAATAATAAAATTGTAGATACCATTTTCTTCGAGCCAAGTCT
GAATGTCTGCTTTCAGGGTCTTGGAATTTGTGGCGGCATTTGTCTGGGTTTTGTGATAACTGACGCCGTCCACGTGAATATTGCAAGGATCATACTTAGA
CGCCAATACAGCACTCACATTATTGAACCACTTTTCAAACTGTTCAGTGTTGAAGTTTCCGTGGTAATCGTCATCGTGCTTTCATTTTAAGTTGGATTGC
CAAACTTCACGTGATTCCTTGATCAGCTTCCCTATAATTCCTTTTTTTCTTTTGCGAATTACACCAGTGGCTATAATACAAAACCTTTTGAAGCAACGTG
AAGATTAAATATAAGCAAAATAAGACAAATAAGCAGAAGAAAAACAGTATATTGGGTCTCGTCCACTTTTGGTGAACCGTATCTTGTCCAGGTCCACCCA
AGACAGATTAGCAACGTGGTGCAAGTTGCAAAATGTTTCGTCAAGAAGCACATCAGGCCGCACCGGAATATTTCTTCTGTTGAGGTTGCCTAGTTTTTTC
TCCAAATATTGCGTCCGAAATGTAACATTTGCCGTAGATTCTGCCAAAATATTCCGCGATTTACCTTTTATAAAGCGCATGCCCATACGTGTGAAGTACG
CGGCGTAGCGATCGCACCGAAATCAAAATGTCGTGCTCTTCCTTTAACCGTTTTGTTAACTTGGGTGCGGCAACAGGCTTTCCACTCTTGTTCATCTCGG
ATACCAGCCCACGCACGAAGGGATTTAAAAATTCACAATGTTTTGGTGGTCTATCAGATGATTTGTTTCCTTCATCTAGCATAAATCATAATGCGACCAA
TGAAATGTTAAGTTTGATATTTAACAATAACAATAGCACACAGAACGCGCCGAGGCAATTTTTGGGTCATGGTACTTCAACCAGTGGCCCCAAACTGTCG
AGATGGTGCCCGTTGCGAAGCCTAGGCACTCATGTACATGATGGCGTACTTTTCCCTTCCAAAGGGATGGTGTCGCGGTTTTCTTGCCTAGGGTGTACTC
GTAGGTCTTCACCACCAGGCATGTTTCACCAGCCGTTAATTTCTTACCGGGAAGCATTTGTGAAATGGAAGCCTCGTGATGCCGAGGTGGTGGTGCATTA
CGTCTGTTTAGACGTTGTTCTCCCCAATGGAGCAGTTGCAGATAAATCTGACCACTGGTTGCCGAGAAATGATTGATTTAAATTATCAATTTTAAATTAC
GATTATCCGTCTAAGCCTTTTTGACCGGGACAATACACTCGGGAGCACTCGGGCCTCTCTAATATATAAGGAACGATACTCCCTCTCGTTTCCAACTCTC
AGTCACTCCTATCTCTTGGACTGACCAGCAACAAACTCTCGGTTCAATGTACCTCAAGCTCGCTGACAGGCATCCCACGCAGCCGAGCGTATCCAGACTC
TAAGATAGGCTAGCTAGACTTACCGAAGACGGACGTGACCCCTGGTGGCTTGGGGGGGGGGCTGCTGATTTATTTCTCCTTTTCCTACAGCTCTGGGAGC
CTCTGTAGGTCATCATTTAGCTAATCCTATATCTATTTACAAATATCAAGTGTAAACAGATATCTGTGGGAAATCGTATAGCCGGCTCTACATAGCCGAG
GGTACGACACCAGATGGATAACAACGAGGCTTTTAACCTCAGCCGGGGTTTTATTAGACCCAGCCGAGACCTCGGTCACTATTTTCCTAGGTCAATATAA
CGCGGGAAATGAGACCTGCCAATCAAGACACTCTGTCGCCTTTCACTGAAAGGTGCAACGTCCGTCGGACCTTGACAGATCGGCTCCAAATTTGTGGCTT
TGGGTTGCTATTTTCATGCACGATGAACGCTAAGAAAAATCTCCATTGCCTACCAGCACTCCGACAAAATCTTCAGTAACTCATGCTTCCTTGCCCATCT
TGTCCGCAGCAGGTGGAAGTGTCAGTATCTCACTTCGTGACTCCAACCGGGCCTCCTTGCGCTTCTGCTTCAGCCAATGGTCTGTACCAATCTCGCCCTT
TGCTCCGCCGTCGGTATACAGCTTCAGTCGCTTCATCATGTCGGCGATCGATGGAGGAAATAACCCGGTGCAGGAAAACCCGCTAATGGCATTGTTGGGT
CGCTCAATAATAGAAGTCTGGTAGACCGCACACGTAATCTGAATGGAGGCTCCTTTGGACAGTACCATGTCGGCTGTATCGTGTAGCTTTGACTGCAGTG
CGTCCGTAACTGCATTTTTGAAAGATTTAAATACGGCGACGTCTAGCGGCTGGCACATATGGGTAGCATTTGGTGGCAGCGTCAGCAGCAAAATTCCTTT
GTCTTTCGCTGCGCCAATTGACTCTTAAATAAAATACCCGTCCAAACCGATAAAAAAATTAATTTCAGTTTGAGCGTATTTGGGTAAATACAGCACGTAC
CGATGTCGAGGTGCGTTGAGCTGTTGTCCAGCACTAACACGATAGGGAATTCAACGCCAAGTCTTGTAACTTAATCCGCAAACATGGACAACCACAGACG
AAAAATACTTCCGTTGCTGAACTCCTTCGGTGCACCTGTCGCCCGTGCACCCTTGATGGAAAGTTTAGCTTCTCGGTCTTGTAAATGTGCTTGCCTGGTA
GAACAATAAGGAGAGGAATCGCAGACCCCGCAGCGTTTACCGCAGCCACCACTGCCATGTGGAAGTTGGGGCGCGTCTCCTTACTCCATACGTTGGGAGA
GCCCCGCCATACTGCCGTTTGGGCTTCACGTTTCGTAGTGCCACCAGGAGAATGTGGTGCTAGCCACCAGCCAACAAGAATAACTTTGATAGTTTTTACG
CTCCTGCAAAAACGTATAGTATACCATACACTAAAGTGATATTGGGATATCTAGCCAATCAGGGGGCGCCACTATAAAAACGCGAGCTGTGATTGGACAA
GAACTTGCATCGTGCACTAAAATGATCCCAGGCACTGAATTGGCACTGGCCGTTACTCTTCCTTCTGAGGGACTGCGGGGGTTCGCGCGAAAGCGCAATA
TTGCATTATAGCCCTCGCTCGTGGCCAGTAGTGCAGGTTTTGAGATTGACCAAACTCAACCTGGGTATACAGAGGTGCTTGCAACCAACCCGGTGTAAGT
GATCGTTCCAAGTCTTCAGGTGTTGATCGAACGCTCGCTGATCTTTCGCGAGGGAAGCGTGTGTTGTTGGTGGGACTCATACCGTTCGGTAGTGAGGTTT
TCTGCGTGTTCCTACACGACAACTGGTGCCGCGACCCGGGATTGGTGTGACCTTCTGTGTGTCTTGGTTGCATATAGGTTCTTGCCCTAACGAGCATTCG
AGAGAAGAAAGAAGAGAAGAAGAAAGAAGATGGCGAAAGGAGCGAAGTCACCGGTACCAGCAACGCTGGTGATGTCAAGTGGAACGCGTACCAAGGGTTC
GGGGCGTTCCGGTCCGTCGTTCGTGACGTCGAGTACGTTGGCGTCGATCAACGAGCGTTCGGACAGTTTTGACGAGCCGATGGACTATTCTGACGTCAAG
GAAGATAATGAAGAAGACGATCTGGAAGAGAAGGCAGCGATGCCCGAGCTTTCGGAAGCCGCTGCAGTGTCTGTAGGATGCAGCGGAGGAGTGATATCGC
TTGCGAGAAACCTCACTGATGCGTTGAACGAAGCGGCTGGTCCCGAACCAGCCCACGGTTACGACGAAGATGGGTCCGACGATCAGCGATCGCCGGCGAT
GGCCGAGGATGCGAATTTTCGGCCGAATGACAGCCGGCCTCCTTTTAACGGAGACACCCCGGCCGCCAACCGAGTTCTGGGCCGATACCTGGAGCTCATG
AAGGTGAAGAGCCATTGGATGCGCTCCTTCGCCCCAGCGGTGGTTCACCAAGCCATCTGGATCGAGATCGGTGGCGAATTCACTGTGCCCGTCCAGTCAT
GGGGTACTTGGCAAGTGGCCTAGGATACGGTGCAGCTCGTAGGCGCTATCAAATACGAGCCCGCGGTATTCCCACTGGAGGCAGACCTCTGAACATGGGC
ACCCAAGGACGCCGCTACGGCGCTCCACAAGTGGAGGCGGGAGCCAGCCGTCAACCGAATATCCGCCACGCACCGGAACCGGATTCCGTTGCCATTGACC
CCTGGGAGACGGCCCAAAGAGTCGACCGAGGCTGGAGTATTTTCGGCCAAGGGTGCGACCTCGACATACTTCCAAGACTCCCACATGGTGACGCCTAGGT
CGGTCAGTCGTACGGAACGACTAGCGAGAGAAGCCGAGGGAAACCGAACCGCTCCAACTGCTAGATGAAGTGCAAGCCGAACGCCTAGCCGACGTTACGA
CCTCCGCGATGACTCATCTGACGAAGATTTGTTCGACATCGGAGACACCGGGGGTGACCTGACGGAAGAATGGGCACGCCAAATCCGTGAGTTGAGCTCT
GTGCGGAAAGAGAGTGCGACACCAAGGCTAGAGATCGCCACGCATCTCCCACTCAGCAACATCAAGCCGTACTTGGGACTCCACGACAAGAGCGAGAAGT
CCATGCAGTGGCTCCGAGCTTTCATATACGAGATGAAAGGGACGCACACGCCGCCCAACGAATGGTGCATGGCGTTTGAACTAAGTCTTCAAGATGGAGC
TCTGCACTGGTACCGACAGCTGCCCCGCAAAACGAGGCGCCCATGGAAATTGTTGAGCGATGCATTCATCAAGTACTACTGTTCACGGTTCAACCAGTCT
GCGAAGGCTCGGTACTACTCGGCAAAGCGAGAGGAGAAAAAGCATGCATGCGACTACCTCAACCGACTCAACGGTTATGCTCGCAACGCCGGAGTGCAGT
TCGAGCATGGTGGTCGTGATGCAAAGGACCACGTCGAGCACTTCTTGGATTCGTTCGAAGACCGAGGTCTGGAAGAGCGTCTGTGCCATGTCCGAGTCAA
GAACATCCACGACCTCGAAGATATGATCAACGATATCTTCCGTCACCGGGAGCGGATATCGGGACGCGAGTCCTCGGTCCGCCGTCCTCGGGGACAAGAA
GTGGTACGTCGACGCGACGGTGGACGCTCCGAGGAGTCGCGGGACGGCTATCGCCGCGACAGACGTCATCGAGAAGATGGCTGCCGTCGAGAAGACCGCT
ACCGAGACGAGAACCGTCGTCGGGATGACCAACAGTACCGACCGAGGGTCACTCTCACTGAAGCACTGACCGACAAAGTGACTGCGCTGAATGCGAGACG
TCCGGCAGACACGCGAGGAGGATACCCAGAAGTATACAACGGGGAATATGATGACGCCGAGGAGTACGGACTGGAGTCTCACTCTGGCGATGACGACCGA
TATTCCGAAGGGTACTCGGACGGCGGATATGCGTCGGCCGAGGACCGAGGCCATGTCGCCGCGGCAAACGACACTGAACGTCGTAATGCGGCTGAGGGAA
CGTTCGCTCGCGCCGACAACCGTCGGCTGAGAGGCAATTAACGGTCAACGCCCGTATGACCGAGGTGACCAAGGCCGAAACTCAACCGGACGCGATGGTC
GACGCCAATATGGTCCATGCGCCGCCTGCGGAGGACTCACCCATTCGGCACACGACTGTTTTAAGCGATGCAAGATGTGCAAGCAAGTTCACGATGCCGG
GAGGTGTGAAGCCTTCCAAGAACTCACGACTCTCCCCCGAGCTAAGGTCGAGAAGAAGGACCTCTCGCCGGAATTGCAGGAACTCGTCTATGGGAGTCAT
TTAAACTAGGCAGCCCGCCAACTGAAACTGGGTTGGTCCCAATCGGGCTGCCACAGTTAGCCAAACCTGCGCTGGATGCGGACTATATGTTCGCATTCGC
AGGTGTGTGCAAACGGCCTGATGACTTGAATATGGAATATGTGAAAACGATGGAAATTGTAGAGGAGAAAGGCGTAAGCCTCGGTGGGAGTGAAGTGAAT
TGGAGACGTACGGAGGGAGACGAAGTGGAGTTAACCGAAGCTTCGATCCTCAGCATGGCCAAAATCGACCATCCATCCCGAGACCTCGGCCAGACTATTA
AACTGTTATCTGGCGAGAGAATGGGGTGGTGGTCATCCCAGCGTTATGACAAGAGGAAGCGATTACGAGCCCTTGTCAATGGGGCTGTAAACGACTCGCG
AACGAGGATTGTGCTAGATACGGGTGCGAATGTCAGCGTAATTTCCGCGTCATATGCGAAACGGTTACGCTTGTGCAAAGTTCCGGACCACGGTAGGAGT
CTGGAAGTGCGGGGAATTAACCCAGGGGTGATGGAAACTCGCAGGCGAGCACTCGTCAAAGTCACCCTGGGGTGGGAACGCGTGTACGAATTTGAGGTAT
GGATTATGGATCACAGTGCAGGAGTAGACGTGTTCTCGGGAACAGATTTCTTGATTCCTGCTGGAGTCCGGCTGGATCTGTTCCACGGCACTGCGAGACT
ACCAGACGAGGTAATGGTGCTCTTGGTGAAGTCGCAGAACCCGGCAGAGGCCGAGCCGTACAGCATGCAAGTGACTGGGCGCCCGACCGAGGACTTGTCG
GTCCCTGGGCGTGAGTGGAGAGAATTTAGGCTACCACGACGGCGGCCGCCTCTGACTACTCATGACGTGTGGGCCCGCCGGATTGGAAACTTGGTGCCCA
CTGTAACGAGGTCTCGACGGGGGCAGCCGACGATGGTGCGACTAACGAACGTGTCACCGAAGATTGCTCACTGCGCGAGACACGAGTCAGTACTGCTATG
GGTGGAAAAGGGCGACCTTCCGCAAGGAAATGGATACACTCGGTTGAACTCCGCCAAGTACGAGAAGTGGCAAGTCCTGGCAAACGAAAAGTGTCGAGAC
GAGACCTTGTTCGAGAGTTAACGCAAACTCTACGAACGATGGTTGGCAGATCATCTGCCTGCGGTGGAACGACGAGACTATCCGACACCTCGCGGCATCC
TGCCTCGACCATCTGACGACTTGGGAGGCCGAGATGAGGGCCAGATAACATTCGCGGATAGGAGCACCGAGGAACCAACAGAACACCGCCGACGACTACG
ATGCGATCCTCTGAGGAACCCGCAGGAGGTAGTTGGGTCGGTGAGGATGCCGACTCAGTGGCGACCGACACCTCTGATGGTGCGGATACCACGTATACGA
GTGAAGAGGAATCCACACCAGTCCTCGGTGATGATCTGGAAACCCGATTGGACTCTGCCTTCGTAGCAATGATGCATGAGATTACCACGGGGGACGGTTC
AGGTAATGAGAACACCGATACCGATACGTCCGAACATTTGGCGAATGAGATCGAGTTGACGGACTATGCACACGAGTTGGCGTTCTTACCGGACCTGACC
GAAGCCTCGGAAACGGTACTGGATTATTCAGGACCAAATGTTCAGAACCCGAGTGCGACTGCCCGTCAACAAGAAGGTCTCGTCGCGGTGCTGAAACGAC
ACGAGAAGATCATGATTGCGAGTGGGAATGCCCTGCCGCCACCGGCCTACGGTGTGGTGTGCGATATTGACGTACAGGGGCATCCACCCATCAAACAAAG
AGCTCGGAGAACACCGCTCCGACACCTTCGGAAGCTGCACCAGCTTCTCAAAGGCTTGCTGGAGGCTCGCCTAGTGGTGTTTTCGGACAGCCCGTGGGCG
TCGCCTATCGTGATTGTGCTCAAGGGGTTGATATTCGGTTGTGCATCGACTACAAGCTGGTAATCTCATTTACCGCGATTATAGAATACGCCATGCCGTT
GGTCGACGACTTGTTGACCGACCTGGAGGGCTACCTATGGTTATGCTCGCTAGATGCAGCTAGTGGCTTCTGGGTCATTATGATGACGATGCGGGCCCGC
AAGGTCTCAGCCTTCGTCTGTGCGCTTGGGCATTTCGAGTGGCTCCGCATTCCGTTTGGATTGAAGAACGCACCAATGATTTACCAACGAATGATCGACA
ATGCTCTGTGGGGTTTTGTCCAACCAAAGGGCGGTTGACTCTATTTTTCGGAGTTTATGCAAACAGCCGAGGCCCACGCCGAGGCTGCACGGACAGGGAT
GATCGATCTTTCACCAGGATTCAACAACTCTGCCGACCAAATTCGAGGCCGACCGAGAGTCCTCGGTCACGCTAGATGCGGTGAATCAGTTAGTGAACAG
CCCGATCGCTGACATGTTCTCCACTGGAGACCTGGATGAATCCTCGTTAGTGCCGGTGTTCGACCGACGGTCGTTTGTCGATGACATCTGTTTTGGGTCC
GAGACTTTCGACGCGTGCCTGGAGACGCTAGACCGACTGCTCCAACGGTTCACCGAATGTCGCATTAGTGTGAGTTTTACGAAGAGTATCTTCGTTCAGC
CGAGGGTAGACTTCCTATCGCACGAAGTCTCTGCAGAAGGTATTCGAGCCGACACCAAGAAGATGAAGGCAGTGACTGAGCTGCCGTTCCCTGCTTCGAA
AAAGGGGATGCAGTCTTTCCTCGGTGCGCTGAATTACTACAGTCGGTTCATCCAGGACTTCGCAGTGTATGGAGCAGCCTTGTACCAGCTGAAGGACGAA
GACTTCACACCTAGTGGCAGCCTCTCGACGGCCAAACGAAGCTTCGCGGCGCTCCAACAGAAGGTTGCAGAGGCACCGATCCTACGGCACTTTTTAATCG
AGACAAGGAGGTGCATATCACATTATTCGCGAATGAGTGGGCATTGAGCTCCACTTTGATGTAATACCACGATGACAAGTTGCACCCGGTCCGATTTTGT
GGCCGAGTCCTCAAGGACGCCGAGATGAACTACCACCCGGCCGAGAATGAGGTCTTGGCACTACTGCTGGTGTTGACAGTGTGCTACTCTCAGTTAGTGG
GTCGGATCATCCACATCTATACGCGATTTTCGACGCTCGAATGGGTGCACAAGTCTAAGACACTGTTCGGTCGAGCAACCCACTTTGCGGTAATGTTGTC
CCCGTGGCACCTGGTGGTCAACCGAGTCAAGGAACGCGATTGCACGTTTGCCCAGCTTTTGCAAGCCGGGCTTACAAGCTTCGTTGAATTGGAAGACTCG
CTGGCCCTAGTTACGCCGCCTACGAAAGGGTCACCTACTGCTCATATGGACCCCCACTTGCTCTACGCCTGCCTACCGAGCTCTAAAACTGGATTTGTGA
TATCGATTGATGGTTCGGCCAAGACCGAAAAAAACGGCGGGTATGGCAGTTGCTCCTGGATTTTGTGGAAATTACCAGAATGGACTGTAGTGACGTGACA
CGAGACTGAGTGCAATTTCTCGGTTGGAATCAATGGGTGACTAGTGACGTGGATATATGCTGATATTTGATTGGCTGCTGAATTTTTTTGAGTACTGGTT
ATGCGCATTGTGCATGTTGAATGTGGAATTCGGCTGTGTTCCGCGGAGCGGATGCGCTCAGGCTTTAAGATGGGCCCCCCAGATTTGGAAGATCAGATTA
GGCTCCAAACAGCCTGAAACTGGATCTATGTCTGAATCAACCCCGTCCTCAAGCGGGTTAACGCAATGGAGTTGAAAATGCCTATGTGAATGTATCACAA
TGGAGTCCCGCCTTGCCTAAAGCCTGAGCGTGTGAATGTCCGTGTACCCGGAGTGCACCGTAAGTCACCAGACGCCAGACAAACAAAAAGCCCGTTGAAG
AAATGCCGTGTGGACCCTCACAATGAAGTATGATTTTGGTCATGAGACCTTGATCACATTAGATGTCTGAACGCAGATGTCTGAACGCGGATGTCTGAAC
GCATGTATTATACGTGCTCAAGACTATCCTGTACTGTGAGGTCGTACACACTGGTTTCAGCTAAATGTCCAAGTTGAAGAACCCTGAGCGTGAGTTCGAA
GTATCTACGTTCAAGAAATTGGAACCTGAAAATGACGTTCAAGGTCAAGTAACTTGAAAGTAGGCTTGAAGAACCCACGTTCAGACAACCCAGAACCCAA
TGCGAGGATTTGACTCCTTGAAGATCCACGAAGTGACAGCCAGTATACTCAAACTAAGTCAAAGTCAGAAGGTCGCTATGAAGAACACAGAAGAACACGG
AAGAACACGGAAGAACACAAAAGAACGAAGACAGACAGATACCCTTTACGAAGAAGCTAGCGATCGGCTAGCAAAGATAACAATCAGAGTTCGTTTAACC
CCCTACTACGCAAGTCGCTCAAAATAAGTGAGCTTCCGACAAGCAGGACACGGGTCCGCCGTTCAGTTAAGGGCAGTTCGGTGCGGGGCTCTCTACAAGA
TTCAAGCCCAGTTACGAGGGGATCATTCACGTAAGTATTTGACGTGATCCTTGCATTCCCTATATTAGTTGGACCCGCTGCGCGTACGGTAAGGGCGGGG
TTTTCATTTCATATTAACAAGGCCTTCTTGGGTGATAGTAGCAGTCATCCCCAGGAATATTTGATAGACTGCGTTTGAGATAGGATTGTATTGGTGTGTA
TTATTTCCCTCATCTGAGGGTGGTGCGCGTGTGAAGAAAAGGCTTCAGGATTGACCAGTATCCTGGATTCAGCCTTAGTTGACTGGTGTTCAGACCCACC
GTTCAAGGGTCTATAAGAATAAGTAACGGCTGCGTGTTGTATATAACTCTGTATTTGTATTGGGTATCTGAAAGTGGTGTTTGTTCCGAGTTCTCGATAC
CGGTTCCAGACATTGGAGAAGTGCGTTCAGGAAGTGGACGTTACGCTCAGCATTTTCAAGGCCTATTTGTATTTTACAACTCATTCTGGTGATATATCCG
AGCTTCCCTCGAAGCAATCGACGCCGATAGGGATTACACAAGGTGCCACGCCACTCTAAATCACGGTTTCAAGGAACCGCGTTCAGGGTTTACACCCCCC
AGGCTTAAGTTTCAGGACTAAGTCTAGGCTACCGCTATACACTTGGGCGAGAAAGTTTCATCGACTTCGTCACAACTGGTGCGCGTGCCCGGATTTGGGG
TCTTAGGATTTCACCGGAGTTGTTTATATTAGTAAGAATTGATTAGTTGGGTCTCGTTAACTTCTAACTACTCTCTAATGGCGGGAGGACGAGGCAAACT
AATAGGAGGACGTGGAGATGGCGGACAAGCAACACGTGTGTCGCGCCGAGCGCAAGGACTGCCTGCAGAAGAGCATAAGGACTTGGACACAATCGCCCGA
GAACGACGTGCGCGAATGAAGGCAGAGCGGGAGGCGAAGAAGGCTGAAACTGAAGACCAAGCAGTTATCGAACCGGAAGCTGCGGAAGACGTAATGTCGA
CTGCGGAAGCTGGTACTGGTAACCAGCGGTCAGAGGTGAAGCCTCAACACATCTCGGAGGAGCAGTCTCAGTCAATGGAGACTGCGCAGGCGTCTGTGGG
AGGCGCCAACGAGGGTTGAGACCCCAGCAGTGGATCGAGTTTCGGACACTCTGCTGCCGGTTGAAGAAGAAGAAGAGCTTGCTGAGGAAATTTATGTCAT
CCCTGTGGAGAGATTGATAGCTGAAGATGTCAGGGACGCATTGCATCCAGTACCAGCGTGTCAAGATCCCTCGTCGCACGACTTAGCACCCATGCCTGAA
ACGGCACCGACACGCACACTGAGTGAAGAATCTGCGCTCCAGAACCTGAACGCGGATCCGCGTTCAAGCTTGACTGTGGAAAGTAACTCAGAGTTAGTGA
CCAGAGAGCCTGATTCAGCACGGGGCGAAGACACGTCGAAGGAGTTCATCGCGCGACAAGTACATCGCTGGAAACAAGTGCGCTCAGGGTTGGTCACTCC
TCCGAATGTGGTGTACGAGTGGCCAACACCTGCACTGGACTTCTCGGTATGGTTGGAAACAGCGATGAGGACGTCTGACTACCTGCGGCACCGTATGGCT
CTGCCAAACCTGGATGCTGCCTGGATCGTCGAGCTGAAACCTGAGCGGAGGACGTTTGGGATTGCTGAAGACCTGACTGCGGTCACGGTTTCTCCAACTA
GGATGACGCCACGTGAATGTGCTGCTTTCGTGCAAACTCTCTTCTTCGAAGCTGGATTTGAGTTCATCAACGTGGTCCCAGATTGGTATCGCACTAGAGC
CTCTCAGATTGTGGTTGGATATGTTCGCTCGGTGGTTGAGGAAGTTCAGCAGATGATCGCGATCGAGCTCTTGGAGTGGAAACAACTCACGGTTGACTTG
CCGTTCAAGATTGTCCCGAACGCGGATGTTCTCAACCCGTCTGAAGTTTTGAACACGATCAAATACGAACCCACTTTGAAGCTGAACGAGGAAGGTGAAA
GTGAAGATCGATTGATGTCGGATTACGAAGTAGAGCTGCTCGGGAATTCGTTTGCTTCATTATGTCGACTCGCGGGTATCACAGTGCTCAAAAGTCCTCG
GGGTCCCCCTGAAAGTGAACGTGAAGCGAAGCGCCCTCAGCATAGACCTCCCCGTCCGCTCAGCATCTCGACACCCTCAGATCATTCATTGCGTCCAGCC
GGAGATGTTGGATTTGACACTGAGGATCAAGTGATGACCAGCCACAGTTCAGGAACTCTGAACGTGTCGAGCAGGATTTCCGATTCTGTCCCAAGTGTGA
TTGGTCCTTCAGGCACCTCAAGTGGAACCGCATACGACACGTCACCAGGAACGCAGACATCCAGAGACAGCTCGTCCAGTTCATCCATGTTGTCGTTGGG
GCGCCCAGCCTCAGCGCATATGTCTCACTCAGGATCAGTCCCAGTGATGATGGCAATCCAGTCTCAGGGGTACCCGGGTGCAGGATATGATGGTGGAGCG
TTGGTGACGCGTACGCTGATCCCAGCTCGACCTGCCTCGGTGGATCAAGATGATGTCGACATGGCTGATTCAGATAGTGCTGGCGCTCAGGATGCTGAAA
CCGCTTCTCAACCGAGACACTCTCAAGCGCGATCGACGGTCAAGTACGGAGGCTCGGGTTTGGCACCAAGCGAATCAAGTTTGAGTGCTAGGGCACCTGT
ACGTTTGACGCGGACGAAGTCCAGTTGCACAAGCACATCACGCCGGTCAAGTTCGCACTCTTCAACATCATCCGGAGCAGAGCAAGTCGCCCTGAACGTC
ATGCGTCAACACCAGGAAGCAGTTGCCCAACTCAAGGAGCAGCAAGAAGCGTTTCACGATCGGCAGTATAAAGCTCAGCTGGAAATGCAGCGCAACATGG
ATCGACAGCTTCAGGGTGCCGCGTTGGAGATTCGTTCGCTGAACGAACGCACAACTCGCGCCGAGGAAGCAAGACATGCCGCTGAACAAGCTTTGCTGAA
GATCAAAGAAGCTCGGGTGGAGGCTGAACGTCGCGCTCAAGCAGCTGAAGAATCGTTAGCACGACCTACTCCCAAGACGGAAGAAGCTGCACCTGAATCT
CATGAAGAAGGGGCTGCCAGGCTGGAGGAAACCATTCGTCTTGAGCGCCAACGTTTGCAGGCTGAAAATGCTGAACAGCTGAGGCGTGAACGGGAGCTGG
TTCAACACAACTTGGAGCAGGCTTGGCAACAACGTCTTACCGAAGTGAATGCTGAACATGGTCACATGGTGAATGAGCGAGCTGAGCGTGACAAGGAACT
GAATGAAAGCCTGAATCCGCGCTTGGAACGCGTACGACAAGCCATGGAGCATTTGAACCTGGAGCGGGAGCAAGAACGTGAGTCCACACTGAATCGCCAG
AAAGTTTTGGCTGACCAGAATCGCGATCTCCGAACTGTCCTCTCCCAGATTCAAGCTGGTAAGCTGACCACATTCCCTGAAGTGACAACCTCGATAATGG
AGAAACCCTCAGTTGAACCCCATTCGGCAATCAAGAGTTCAGTGGTCAGTGGCGTAATCAAGGATGGCGTGCGTCCTGATACAGAGTCGGTACCATCAAA
GAACAAAGGGACGAAGGCTCAACCAACCACAACCACTTCAGTCGTCAAAGCGGAAGGTTCCAGCAAGGAATCCAAGTCATCTGTGCCTAAGAAGACTTCA
TCCAAGAAATCAGCGGTCAAGAAAAGTGCAATCAAGAAAACGAGTTTCAAGAAATCTCCGCTGAAGGAAAAGAAAGGTGCAGATCCTCCATCTTCAGATT
CAGATGAATCTGATTCAGACTTGTCGAGCTCAGATGATGATGATTCAAGCTCAAGTGATTCAGACAGTAGCTCCAGTGATGAGGCGGGTCCAAACCTTAC
CACTATGTCCACGACGGGTAAAGATGGTCAAACGATTTGGACCTATCGACCGTATATTAACTACAATGCGGTTGAGAAGTTTGATGAAGATGCATCTCTC
GAAGACCGAGTTGGATGGTGGGAGCGTTTCACTGATATGGCGGATCAAGGTTTGTGGCCAGACAAGATGAAGATCAGACAGCTGAGAGGGAGAATGTCAT
CGGCTCTCAGAGATTGGTATGTCCAGCTGCCTAAACATGTTTGTCATGACTGGAAGAAGTTGACACACCGTTTCAAGACCTTGTGTTGCCGCACAACTGG
TTCTTACTCGGAGCGCTACTACACTATGAAGATGCGTTCAGGAGAATCCGCGCTCAAGTTTTTCTATCGGCTTAACGCTGCTGCGGTCAAGGCTGAGGTG
GAGTTTCAGAAGACCACCAAGTCTAGCGAGAGGCACATTCGTCGCTTCATTAAGAAGTTGAAGGACAATCAGCTGAAGACCGCATTGCAAGGTCAAACAT
TCAAGAGCATGAGTGAGATGGAATATGCGTTGAGACGTAGCGAGGACATTTGGCGAGAAGAAGGATATGACACGCCACCGGCCAAGCAGCTGTATCAAAA
CAATGCTCAATCACCGCGATACAAGTCTCGGAAGATGGGCAGAACGTATGTTGCCAAGGCTGAGCCTGAATCAGAATCGGAGGTATCTCACCATGTCCAG
TTTGAAGAATCTGAAGCGGAGGAGAAAATGTCGGTTCCTGCTGCACAGGTAGCGCTCGCCAAGGGACGTGGTGTTCGGCACAATGAACCTGCCAATTCTG
AAACACAACCCATGCGTAGCCTGGAAGATGTCTCAAACGTCGTTTATC