Description :
From Genome Similarity Track
Location :
Scaffold_5:575381- 578498
Sequence
3117 bases(100 bases per row)
tgcttgccaaccgcgcgaccgcactttggactccgcgcatcgtgttcaaggccacctgggtggcacccgaagacacggatacgaacggcccctcggacat
cgacctgccagagcgacttgagcgaacggacggagaccggcgagtggaacgtctcgagccacgactcttggagcgtcggctacgcctgtgggtgccttcg
ctgttcgaacttccggaggatgaacgtcggcgaaagtcatgtcggcgcgagtgtctcgaagacttggtctcctgctatcgaacgccagccgaccccaacc
ccgacataacgacatcgtcctggtcgactggtgttctgacaggcgggagtacttcacgcttgattgaaacccccgtgacaccgccggttgacaggttggc
gcctacactctgggccatcagggctatcggaatgtgacctccggcagaccgaccaatgctccatccggatgacagtgatgaactgtctcgcgacgtgaag
gtgccagaggcaacactcggcaaggactgatccgacccaccggtcgtccaaaagcgactcgacgtgtggttcgacccgctcattcggacgcgcccctctt
ggaactcatgttcaaggacgcctccggggagatcgtcagcagagattccgacggacttgacgaagctgcgggacgcggcggctggtattgtggacgcttc
gggcggggctcgacgtcggtggaccctcgcgggcttcgcaccttccggagcccagctaccctcagctgcaacacatactcgcgtcccagaagattagcct
cgtaatcgttcatcagtaaatctccctgatagttttcggcgtgatactccaaccgtgatggtcttgactttgcttcgacttggactccaaagcgactgtc
ggtttcatgagccaccttgaccatttgtctccactcgatcagctcgaccgccaataactgcagcatgtcagtaacaactcggcgaaccaaatctggatgt
ggcttgttggcacgcgtccgaaaccatcccgataccaggttgacaagctcgaaaccagtttccatcaatagagtctgaaggaccgcggcgcactctctcc
gagaaaacatcgccggcgtaatcataacagcattccgatcttgagcagtgacaaatgcgacccgcttaatttgcatctccgagatccacgcgtcggcttg
actcgtcatcgacatgcgtcggtccagatactctgaagtcaccaggacggcggcgacgaacgaactggaatccaagaaaccctgtggaaagtccaccttc
actgtcggggggacactcttttcagattcgtcccgctcccaacggcgaacttggtcagccacataagatttggcttgGGATTCAGCCAGCATTTTGTAAT
CTCCAATCGTGCTCTCAAGAGCGTCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNN