Description :
From Genome Similarity Track
Location :
Scaffold_8:575212- 579076
Transcript NameFunction/comments
Physo_129608daunorubicin resistance ABC transporter ATP-binding subunit family protein

Sequence
3864 bases(100 bases per row)
GGCGCTGGATGTGAACCCGAACATTGAGCGCGTGAGTGCCGAGCTCCGTGAGCAAGAGCGGCGGGGTGAAGTGCTGTCCATTCAACGTCTGGGGAAGGTG
TTTGAGGTTCCAGGCGGTCAAAAGGTGGCACTGAAGGGGCTAGACTTGATCACGTACAAGGACCAGATCACGTGTTTGCTCGGCCACAATGGAGCTGGAA
AGTCGACGCTGATCTCGATGCTCACAGGCATGACGGCGCCATCGAGCGGTGACGCGAAGTACCGTGGTCTCTCGCTGAATCAAGACATGGAGGAGATTCG
CGAATCGCTGGGTATTTGCTTCCAGCACGACGTTCTGTTCGAGGACTTGACGGTTGAAGAGCATCTTCTAGTGTTCGGACGGGTGAAAGGATACAGGAAT
GAGGAGCTGCAGGGACTCGTGGACTCACAGATCCGTCAGGTGGGTCTTACGGAGAAGCGCCACGTCCTGTCCAAGGAATTATCCGGCGGCATGAAGCGGA
AGCTTTCGGTCGCTATTTCTCTCCTGGGTGACAGCTCCCTGGTGTTTCTGGACGAACCGACCTCGGGTATGGACCCCTACAGCCGTCGTAGCACGTGGGA
GATCCTCCTCAACAACCGCAGTGGCCGTGTGATGGTGGTGACGACCCACTTCATGGATGAGGCCGATATCCTGGGAGACCGCATCGCCATGCCATCATGG
CAGAAGGCGAATTGCGCTGCTGCGGGTCGTCGCTCTTCCTCAAGAACCGGTACGGAGCAGGCTACAACCTCACTATCGTCAAGGACGACGCCAGGTGCGA
CGACAAGGCCGTCACCACGCTCATCAGGTCGTACGTCCCCTCTGCTGAGCTGCTAAGCAACGTCGGCAGCGAGATCGCGTTCCAGCTGCCTCAAAAGAGC
TCGCCGATGTTCTCGGTCATGTTCACCGAGATGGACAACAATCTGTCCAAGCTCGGCTTGCTCTTGTACGGCATTTCAGCCACGACGCTGGAGGAGGTTT
TCATCAAAGTGGCGGAGGCTGACGATGAGAACCACCAACACACTTTGGGCCATCGCACGCGCCCGACGGAGAGCGAGGCTGCTCCTGTAGCGGCGTTGCA
GACATCCGGTCTGTTCTTCTCGCACTTGCGCGCTCTCCTTCTCAAGAGGTTCCACCACGCCAAGCGCGAGAAGAAGATGATCATCTACACGACGTTCTAC
CCGATTCTGCTGCTTCTGGCAGGTCTGATTATCTTGAAGAGCAGCAGCACGACGTCCGATGACCCGAATCTGGCGCTGAACACGAACGCGTACAGCTCCG
ACAATTCCACACCGACCCCGTACTTCTGCCAGGCTGGAGGTGAATGGTGCAGCGATGTCATGGCGTCGTATTTCTCTGGAGCAGAAGCTCAGGAGCTCGC
GATTGAGTCTCCGGCTTACGACTCAAACTCTCCGACCGTCTTTAACGTCACCTACTCGGACCCGGAGATCAACGCGACGGACGCTACCGGCTTCGGGCTT
CGAATGGGCCAAACGCTGTACAACAGAGGCTACGGAGCCAACAACACCGAAGCGGTTGACGATCAGTACAGCGCGTTCATGGTCTATGGAGACAGCGACG
AGCAGATCTTCAGCTACAACCTGTTCACCAACACTACCGCCACGCACGCGCCCGTCATATTCAAGGCGTTGATGGACCAGGCGATCTATCGGTTCTTCGC
TGCCAACTCGAGCGATTCGACGGTGGATCTTACGGTGAACAACCATCCACTACCGCTCACAGCGGCGGCCAAGGCGCTCTTCGGCTCCGTTTTGGCCTTC
AGCGCGTGCGTCTTTGTCTGCATCTCGTTCTCGTACTTCCCGCTGCCGGTCGTCGTGTACCTGGTGAGGGAGAAGGAGGCGAGCCACAACTCCAAACACC
AGCAACTGGTCTCGGGCGTCTCGCTCACTGCGTTTTGGCTCGCCAACTACCTCTGGGACCTCATGATGTTCGCCGTGCCCTGCGTCGCGGCCATCGTCCT
CATCAAAGCGTTCGATATCTCGGCGCTAACCGGCAACTCCGAGTGCTCGAGCTGCACCTCCGAGACGTTTCCGGCGGTGATCCTTCTCTTCATCCTCTTC
GGCTTCGCGATCTGCCCGTTCACCTACTGCCTGTCGTTCCTCTTCAAGGAGCACGCGGCGTCACAGACGTTCACCATGAAGATCAACTTTCTGCTGGGCG
TCGTGCTCATGATCGTGAGCTACATCCTCGACGTGATGGAGTCGACCGAGTCGGTGAATTCAGTGCTCAAGTTCATCTGGAGACTGTCGCCGCTCTTCGA
TCTAGGCAACGGACTGCTGTCGCTGGTGTTGAACGAGCTCGACACGCTGCAGGACGGCACGACGGAGAAGAAGAGCCCGTTTAGCATGGACCTCATGGGC
GCCGAGATGATTTACCTGGTGCTCACGACGTTCCTCTTCTCGGCGGTGGTGCTTGCCATCGACTACGGCGTGAAAATCCCCGGACTCCAACGCAAGAACG
CAAGCGCTCAGGGCGTTGACGATGGGAAGTTGGATATCGACGAGGATGTGGCGAAGGAAGCTCAGCGAGTCGCTAATGGGGCTGCGAATGAAGATGCAGT
GAAGATTGCTGGACCGAGGAAGGTCTACCCTGGTGGCAAGGTGGCCGTGAGAGACCTGTCGTTTGGCTTGAAGAGAGGCGAGTGTTTTGGCTTCTTGGGC
ATCAACGGCGCCGGCAAGACGACGACGATGAAAATGCTGACGGGCGACGTCGCTCCGAGCTGCGGGACGGCAACACTCAACGGCTTCGACATCTTGACGC
AGCAGATCGAAGTGCGCCGACAAATCGGCTACTGCCCGCAGTTCGACGCGCTGTTTGAGCGGATGACGGTGCGCGAGCATCTCGAGCTCTTTGCGGCGAT
CAAGGGCGTGGCTCGAGCCGACATGGAGGCAGTTGTGACGGAGAAAATTCAGCAGCTGAACCTCGCAGACTTTGAGCACAAACTGGCGGGAAGTCTGAGC
GGCGGCAACAAGCGCAAGCTGTCGGTCGCTATCGCGTTGATCGGCAGTCCGCCGATCATCTTCCTGGACGAGCCCTCCACCGGCATGGACCCGGTTTCCC
GGCGGTTCATGTGGGATGTGATCGCCGATATCTCAACGCGAGGCAAGGAATCCACGATCGTCTTGACAACGCACAGCATGGAGGAGGCTGAAGCCTTGTG
CTCTCGAGTGGGGATCATGGTCGGCGGTCGTCTTCGCTGCTTAGGCAGCGTGCAGCATCTCAAGTCTCGGTTCGGTGATGGCCTCGTATTCGACACCAAG
TTCGAGTCTGTGGCTGCAGACGAACTTGATCGTCTAGTGGAGAGAGTCTTCAGTGACGGCAACGCCTACGTCACACCAGCAGATCTGGAGGACAAGTGTC
GTGCGTTTGGCAACGTCGATCTTGCTAGACTCATCACTGCCGCACACCCGACGGGTTACAGTCTTGCTGCAGCGCTGGAACGAGACGGATTCATTCGCGC
CGAGGCATTCTGCGCGTGGTGCGTGGAGGAGACGCGATTCAACGAGCTCAAGGAGTATCTTCAGCAAGCGTTTGGAGCCGGTGGGGTTGTCGTACTCGAA
AGGCAGAGCGACTTCTGTCGGTTCAAAGTGCGCGGCGGCCCCAGTGACGTGAAGCTCTCCAGGATGTTTGCATTGATCGAGGACATTAAATCCACCATGC
ACATCCGCGAGTACAGCGTCTCGCAGACGACGCTGGAGCAGATCTTCAACTCGTTCGCTAGTCAGCAGGAGGAAGAGCAGGGTGTGGCTCGAGGCGTCTT
CCAGGCTGCTTAGAACATGAAGCTTTAGACCCTAGCGGCGTATCAACGCTGAACGAACTTGAAC