Description :
From Genome Similarity Track
Location :
Scaffold_8:575055- 577648
Sequence
2593 bases(100 bases per row)
TCTCAGACAGGAGCTACCGTGAGTTTGATCGTCGAGCGAGCTATACGACGAAGTGCCGAGCACTTCACACTTCTCAACTAATCTATGATGCGCCATCGAC
AGAGATAAATTCTCCACCCACAGCACTTTAGCGCAAGCATTTAGCCGCCAATTTTGGAATACCGCTACGGTTTTCAGCCGACTGCTAGCACAACTGGTCC
TATTCATAGAATAGAATTTGGGATTACCGTTGGCGTTACTCTAACGTACTTATTCAATAGCCCCAGTTCTATTCGTAAGTCACACGTACTTAAATAAAAT
AGCGGTACAGAAGTCCCCTCAATAAGCGTAGAGGGCCGTCTGACAAATTCTCATAGGCAAATCATTGCAAACTTTTGATTTTTCCAAGGTACCTTCAATT
TTTGTGATCCGATATAACAGGGTATACGAGGTGCAAGCAACGCCTTTCCAGGGGACTCTTCAGTGCTGTATCCGTGTTGTTCGCCGGAGCCAAAACCATG
AGCCAGGCCATCGATCAACATAGATCCGGTGGATAGTTAACGGTACTGTATGCTCTGGATTGGTGCATTTTGCAGATTTGAAAATGCAGCACCACGAGAA
AATATGTTCAGCACAGTAAGTATTCTGACAAACACAGTAAGATCCATTTTAGCACACGAACAAGGAATGACCTTGGTCTGTCTCGACTCGAGACTCTCGA
GCCGCACTGCAAAATGCAAAACGGAACGTTCCAAGAATTGTCTTTGTGATTGGTGGCTTGGGCCTGCAAATTGCCAAACGGCGGAGCAAAATTGGGCACG
AAGAAGCTGTCTCTCCGGAGAGACTGTGGCGGAAGGCCAGGGAGGCCAAAGCACTGGAGGCGTGGCTGGCACCACTGCAGACGCCGGGTGTCCGTGCCGC
TAGTGCACTTACTGCTGGTCTGCAGCGCTGGTAGTAATATATACGACAAGTTGGTGACGCTAGTGACGCGTCCATAAGTATGTGCAGCTACAAACTGCTA
TACAGTAGCCAGATACGATGTTGGAAATTGTTTAGGTACCTCAAAAAGTATGTATTTCTGCGCGTCGCTTACTCGCACTACAGAGCATGACCTGCATGCC
TCTGACGTCCTACCGTTTGTGCAACAATTTGGTGATCTTCAATATCCAAGCCTCGTTTTCTGCTGCGATTTACCATGAGACGCTCGCCTTCTCCGTCGAC
GTAATTGCGGCACTGCAGTGCAAATTGAAGATGCACGCAGTCTCTCATCTTGAAGTGGTACCGACATGGACAATGTAGTACATCCAAGCTGACAGGCCAT
CCTGTGCTCGGCTGTCCCTCTATCTCCATCCTGGCGTAGTTCACAGAGAACTGAGCTGCAACATCGAGCGCTTCTTCAGATCGGTCTCGCGACGGGATGT
AGAAGCGCTGTGGAGGCGTAGCAAGCACACGAAGGATGTTACTGCTCCCATTGTCCACCAGAAAACTGATACTGCTCCTGCTGAACGTGTGTTCCGCCAG
ATAACCACCACGCCGAAGTGCTGTTGTTCGTGCAACCAGGCGCTTGTCCGAGATACGTCTAGGCGCAAATTCTGTCGGTGCCATGGACCGATGACTGCAA
CAGTACTGCATCTGTTGAAGCAGAACGGCAAGCTTCAGCTTGCGCTTTTGCGTGTAGTCACGTTTGAAAGCTCGGTTAAAGGTTTCGCACGGATTGTTTG
TTGATGCGAAGCCTCGTGGTGTAAAATAAACCTGCCACTTACAGAAGTTTCCTCGCAGCCATTGCTTCTCCATGTACACACGAAACGTGTCCAGCTCCGA
ATGCGTTCTCCAATCCGCCAAGACTTTCATTTTTCGTGCCAAAAAATCTTCCTTATTTGCAGCAAAGTGAAGATCATAAATCCCACGAAACACTTCAGCA
ACCAGATTTCCATGCAGTCTGTTAGTGCGCCCCTTTAGGGCAAGCCGAACCTTAGCTACGACATGATAATAGCACATAAGAGATATGTACTCACCAGCAG
CACCAAAAACGGTTTTAATACCGTTAAATTGGGCTTTGTCTGCGTCGCCCATAATATACTGAGCATTCAGTCGCTTGCCAACTACTTTGGTGTAGATTGT
CTGCAACCCTGACAAGGCATCCGTGTAGTGACGTTCTTCCAGCTGCGATGTAATAAAGAGAGCCGTTAAGTGGGACTGTCTCGCGCCACCGCATACAATC
ACAGGGTAGCTAGTCTGCGCTAGCTGGAACGTCGCGTCGACGTGGAGAACGAATGAGGCCGGATTCGGTCAGCAGAGCGCAACAATGACTATGTCGTCAC
ACCCACAACAAAAGGGTGGGTGTCAGATCCATCACCAACAACGGGCTTGCCGAACCCGTCTGTTCTAGCGGTAAACGTGAAAGCATCATGCTCCGCCTCG
CGGCCGCTGTACGCCGCGGCGGCTACACGTGATGAAAGCTCTCCGTAGCGGTCACTTCCACCTAATTCTGTGCGGCGGTAGTGGTTCACAGCATTTTGAA
CTTTGCGTAGCTCTGGCAGCTCTTGTAGAGTCTTCCCAAACTTCCGTATCATGGCATGCAAGATACGGAGAGGGAAAGGTTTTCTCTGGTTAA