Description :
From Genome Similarity Track
Location :
Scaffold_72:5750- 9900
Transcript NameFunction/comments
Phyra_82417pleiotropic drug resistance protein ABC superfamily

Sequence
4150 bases(100 bases per row)
GCCTTTCACGACTTCGTAGCCCAGCAACTAGAACCAGCACTTGGACGCCAGCTACCGCAGATGGAGGTGCGATGCAAGAACTTGTCCGTCATCGCAGAGG
TGCCAGTCGTCAAGCAGTCGTCCAGCACCACGACGTCCGAGCTGCCCTCCGTCTACAACAGCCTCAAGCACGTCGTGCGAAAGCTCACGGCCTCCAGACA
CACCACGCAGAGACACGTACTCAACGGAGTGGACGCCGTGTTTGAACCGGGCACCATCAGGTCAGCCTGGCTCCGGCAAGACGTCGCTCATGAAAGTCTT
GAGCGGCCAGTTCCCGATGGAGAAGAACATCACGGTGCAAGGTGACATCTTGTACAACGGCCGGTCGTGGACGGAGCTGCTCCCCAAGCTACCGCAACTC
GCTGCGTACGTGCCGCAAACCGACAAGCATTTCCCGGCGTTGTCGGTGCAGGAGACACTCGAGTTCGCTCACGCGTGCTGCACGGAGGAGGTTGCATCAC
GACGTGGCAAGGGCCTCCTATCTCACGGCACACCCGAGCAGAACGAGACAGCTCTGCGTACGGCCGAATCGCTGTACAAGAACTACCCGGACGTGGTCGT
GGAGCAACTCGGCCTGCAGACGTGTCGTGATACAGTGATCGGCAACGCGTTGAAGCGAGGGGTGTCTGGTGGTGAGCGTCGGCGAGTTACGACGGGTGAG
ATGGAGTTCGGCATGAAGTACGCGACGTTCATGGACGAGATCAGCACTGGACTCGATAGCGCCGCAACTTTCGATATCGTTTGCACGCAGCGCGACATCG
CCAAGAAGCTGCACAAGACGGTGGTGATGGCACTGCTGCAGCCTGCGCCGGAGGTGTTCGAGTTGTTTGACAACATTCTGCTGCTGAACGACGGCGAAGT
GATGTATCATGGACCCCGTGAACAAGCGGTGCCGTACTTCGAGAGTCTGGGCTTCGTGTGTCCACCTGATCGAGATGTGGCTGACTATTTGTTGGATCTG
GGCACGGACCAGCAGTACCAGTTTGAGGTGGCGAAACCTCACGCCTCGTTCTCTCTTCAGACTCCTCGGCTGGCGAGTGAATTTGCGGATCTATTCCGTC
AGTCGGCTACCCACCAAGATGTCGTACAAGCTCTGGATGCTCCATGGAGTAGTGAGCGTTTGCACGACGCGGAGCACCACTTGGTGAAGATGCCAGAGTT
CCGACAGTCGTTGTGGGCAAGCGCCTTGACGTTGACGCGTAGGCACTTGAAAATCGCAATTCGCAATACGGCTTTTATTCGCGTGCGTACCTTTATGGTT
GTGGTAATGGGACTCGTCTACGGCAGTACATTCTACAACTTCGACCCAACGAATGCACAGGTGGCTCTGGGGGTCTTATATCAAACCACTATGTTTCTGG
CATTGGGCCAAGCATCACAAATGCCAGTCTTCGTCGCGTCACGCGATATCTACTACAAGCACCGGCGCGCAAACTTCTACCGTTCGCTATCCTTCGGGAT
TGCTAGTCTTGCCGCTCTTTTTCCTACGGCTGCAGCTGAATCGGTGGTTTTCGGGACGCTTGTGTACTGGATGTGCGGGTTCATCGCAGAGACAAGCTAC
TTCCTGCTTTTCTTGCTCTGTATGATCCTCACGAACCTCGCGCTGTGTGCGTGGTTCTTCACGCTAACAGCCATGTCGCCCAACTTCAACATCGCCAAAC
CAATGTCCACGTTCTCCATCACGTTTTACGTGGTGTTTGCAGGCTTTGTGGTGCCCAAAAGCCAACTCCCCTATTTTCTCGTTTGGATTTACTGGGTCAA
CCCGGTCTCGTGGTGTCTGCGAACGCTAGCTGTGAACCAATATCGTTCACCAAGATTTGATGTGTGCGTGTACGACGGCGAAAACTACTGCGAGCAGTAC
AACATGACTATGGGCGAGTACTCGTTGTCCCTCTACGATGTACCTTCGGACAAAACGTGGGTGTGGACGGGTGTGCTGTACCTGGTGCTCTCAGTCGTCT
TCTTTGTGGTAGTCGGGAGCTTTATCCTCGAACACAAGCGTTATGATGTCCCTGAAGCGACAGTTGCTGTTGTTGCAAGCATTGACGAGGGCAAGCAGGA
CCTCAGCACATCCAGTGCAGCCAGAAAACAGTGCGAAGAACCCGCCAGCTACATTGAGGCTGCCACACCACGCTCTAACGCACAAGCAGCACAAGACGAC
CCAGCGGGCATGGTCGTGGTGGACCTTCAAGAGCAGCAAGTGAGCTTCATTCCAGTAACGCTGGCCTTCAAAGACCTATGGTACTCCGTGCCCCTGCCTC
ACCACCGACACGAGTCTATCGACCTGCTCAAGGGAATTAGCGGCTACGCACTACCAGGAACTATGACAGCACTCATGGGTTCGTCCGGTGCTGGCAAGAC
CACACTCATGGACGTCATCGCTGGTCGCAAGACGGGAGGCACCATCCGCGGCGAGATCTTGATCAACGGATACCCCGCCACAGAGCTCGCCATCCGCCGC
TGCACGGGCTACTGCGAACAGCAAGACATCCACTCGGAAGGAGCGACGATCCGAGAGGCGCTCACGTTCAGCGCTTTCCTCCGCCAAGACGGCAGCGTGT
CGGAACGCGCCAAACTCGCGTCTGTCGAAGAGTGTCTCGATCTACTGGACATGCGTGCCATCGCCGACCAGATCATCCGAGGACGCTCACAAGAGCAAAT
GAAGCGTCTGACCATCGGCGTGGAGCTTGCGGCGCAACCCAGTGTGCTGTTCCTGGATGAACCTACAAGCGGCTTGGACGCACACTCAGCCAAGGTCATT
ATGGACGGCGTGCGTAAGGTGGCGGACAGCGGCCGCACCGTCGTGTGCACGATCCACCAGCCTTCGTCCGACGTCTTCTTCCTGTTTGACAGTTTACTGC
TGCTAAAGCGCGGTGGTGAGATGGTGTTCTTCGGCGAGTTGGGCAACACTGAGCCAGGTGATCGCGAGTGCAGTCACCTGATCGACTACTTGGAGGCCAT
TTCGGAGGTTCCGCGACTACCGGAAGGTCAGAACCCGGCGACGTGGATGTTGGAGTGTATCGGCGCTGGAGTGGCGGGTGCAGGTGAAAAGCCACTGACA
GACGCCGCTGCAAACGTGGATTTCGTGCAGCACTTTCGCGAGAGTGCGGAGCAGCAGACGCTGTTGGATGGACTAGCTCAGCCTGGCGTGACGTCGCCCG
CACCTGACCGACTACCAGAGTTGGTGTTCACGAACAAGCGTGCTGCCAGTCCGTGGACCCAGTTCCGCATGCTGATGGGGAGGTTCATGGCGATCTACTG
GCGTACGCCGTCGTACAACCTCACTCGGTTCATGATCGCGTTCGGTCTCGCAGTGATTTTTGGTTTGGTACTTGTCAATGGTGAGTACACGACATACCAA
GGAATCAACACAGCGGTTGGCGTGATCTTCATGACGGCGCTGTACCAAAGCTACATCTCCTACGTGGGTTGTTTGCCATTCACAGCTCGGGAGCGCGTCT
CTTATTACCGTGAGCGCGACTCGCAGACATACAGCGCTTTCTGGTACTTTGTGGGAGCCACAGTAGCGGAAATTCCTTTCGTTTTCGCCAGCGGCTTGGT
CTTCACAGTTATCTTTTACCCTCTGATGGGCATCGGGACGTTCGGTACAGCCGTGTTGTACTGGATCAACGTCTCTCTTTTCGTGCTCATGGAAACGTAC
CTCGGCCAAATGTTCATCTACGCACTACCGACCGTGGAGGTGGCCGCCATTGTAGGCGTGTTTATCAACGCCATCTTCCTCTTGTTCGCTGGCTTCAACC
CGCCCGCTGGTTCCATTCCAGACGGCTATCGGTGGCTCTACCAGATTTGTCCACATCGTTTTTCGTTGTCGATTCTCATCGCACTCCTGTTCGGTGACTG
CCCCGTAGACCCGACGTACGACGAGGCCACGCAGTCGTACATCAACGTAGGTCCCGAGATTGGTTGCCAGCCGCTCCAGAACGCACCGCTGTCGATCGGT
CACACCACCGTGAAAGACTACGTCGCAGTCGTCTTCAGGATCAAACACGACGACATCTGGAGCAACTTTGGCTACGTCTTCCTCTACATCGGTGCGATCC
GCGTGATATCGCTGCTTTCTCTGCGGTATCTCAACCACCAGAAGCGGTAG