Description :
From Genome Similarity Track
Location :
Scaffold_952:5750- 7512
Transcript NameFunction/comments
Phypl_g11794conserved hypothetical protein

Sequence
1762 bases(100 bases per row)
GACGGACGCCATGCAGCTTCGGTTCCCATTGCCGGCGGGTTTCTTCGCCAAGTTCGACTTGCTGCCGAACGAGGCGCAGAGCTACCGgtcgctggccagc
gacATCGTCCGTGAGACGAAGCGGGATCTGGACCACTACGTCAAGGACGGACGCAACCTCATCGACGGTCACACGTGGAAGCTCACTAAGTCCAAGGAGC
GACTGCACTGCTAccggaagcgcagcacgcaaGGCTCGGCCCGCCAGCTCGGACTCTACGGCAATGCAGGTACCGACGCAGGCTCCTCCATCCCCAGTGG
CAACGACTCGATCGGATATTCGGCACGGTCGCGCCCGTCGATGAGCGTCACGAGCTCGCACAGTCGGTCGGGCCACGAAGACACGGGCAACTTGTCGGTG
TCGACGCGgtcgtcggacgacgacgaaccgAGTCGCAAGGGCATCCAGCCGGCCGTGATCGGCTACGGCATCGTGGACGGCtccgtggacgacctggtcT
ACGGACTGTACCAGTCGTCGAccgacgagatgaagacgctgtcCGCTTTTCTAGGCGAAGACTCGCTCATCGACTGCGCGGCGCTGAAAACGATTCGACA
GACGCGCTCGTCATACTTGGGGCTCAAGTGGAAGCTGTCCCGCACGGTCGGTGGCAACCGAGACTGCTGCTACATGGAGTACGTCGGCGTGTCGGAGGAC
GCCAACGGCCAGCGCTTCGGATACCACGTGCTGGAGTCCGTGGTCGTCCGCAACTGCCCGCAGTTCGACGACAACTCGATCGTGCGCACCAACATGtcct
tctgcttcatcttcaggCCGGGCAAGCTGGCGGACCAGGTGGAAGTGTTCATGGAGGGCGCGTACGATTCTTCGGCCGACGTGCTTACGGCCGGGGGGGT
GGGCGACTACCGCAGCTCGATGGATATGCTGTTCAACCTCCCCACAGCCATGGTAGGAGCTGAGGCGAAGAAGATCTCAGCTATGGTGACCAAGCAGTCC
GGTGCTCTgcgcggcgcgagcagcaagaaccaGAGCGGCAACCACTGCTCTATCTGCCGTGCCAAGTCGGGCTTGCTATCCTCGCACACAAACTGCCAGA
CGTGCGGTGCCGTCATCTGCAGTAAGTGCCGCATCCGGAAGGTGGTATTTTCACGCCGGGGCAAGATCAAGGTCTCGTGCTGCAAGATGTGCATGGTCAT
GGTTAGGGACCAGTCGCCGTTCGcaggcgagcagctcgagcagcaaccagcgaagcccaagaagaaaatgaCGCGTGTAGACAGTCGCAGGAGgaaggac
agcagcagcagcagcaacgtcagaCTGGACCTGATCAACACGTCCGTCTCGACGATGTCGCTCACCGACTCCGagttctcgtcctcgtaccAGTCGTGGC
AGTCCAGTTCGATGTCTTCGCTGCAGTCGGACCACGACGACTACAACTCGAATGTCCCTAGTAGCGCTATGGTTCCACTCGAGCGGAAGATGCCAGCTCT
CATGGAGGGTGAACTGCCATCAATGACTTAccagagcgagcagcagcagcagtacgagcagcaacagttccagcaggagcagttCCTCATGCGACAGCGC
TTGAAGCAGAGCGCTGACCCGAACATTCCTCCGATGCCAAGTCAGCGTCAGCCACCTACCCGCGAAGGACTGTACAACCAGATGCTAGAACTGCAGATGC
AGGCCGAGCTGACCTACAACTTAGCCAACCAAAATGCCAACATGATGAACTCGAGGCGATAG