Description :
From Genome Similarity Track
Location :
Scaffold_175:575- 2545
Transcript NameFunction/comments
Hyaar_Emoy2811895ATSMC2 transporter putative

Sequence
1970 bases(100 bases per row)
GCTGTTGTTGCAGTACCTCGACCTCGTCTTCCACCTCTTCAATCTCGCGTTCAATGTGCCCTTCTTCTTCCTTCAGAGCTCGTTGCGCCTGTTGCATCTT
TTCCACATGCTGCGCTGTATTCTTCAATGCGTCTTGTGCTTTTTGGTAATCAAAAGCGACACAAAAGCGCTGAAGGCGCTCCATTTCAGTGTTATTAGCA
GCCCACTTTAAGTAGTGCGTTTTCTCGGCCCGCAATTTCTCGAGCGTCGGCGTGATCTCGTTGGCTAAGATGCTATTGATCTCCTCCACCTTCTTCTCCT
TCTTGGTCATGGTCTTGAGTGCCGCGAGCTTCTTGTTCTCGTACATCCTCGTGCCCGCTGCTTCTTCAATCATGCCTAGAATTTCCGGTGGCTTCATATT
TAAGACCTTTGTGATCCGGCCTTGCATGATCAGAAAGTGCGGGTTGTTCACATTGAGCTGCACCGAGTGAAAGAGGTTCTGCACTTGACTCACTTGGGCC
GTGTGGCCATTGATTAGATACTTGTTGCGTCCGCCAATCACGACTTGACGAGCCACGGACATCTGCTCGTACTGTTCGTAGCCCACGGGCGAGGCTTTGG
CGTCCTGGTTGTTGAACACGATCGTGACACTGGCTTTGGTCACGCCTGCTTGGCCCTGTTTATACACGAGTTCCTGCAGGTTATTCGCCCGCACTTGCGA
CAAGTTGGTGATGCCTAAGACGAAGCAAATGGCGTCCAGCACGTTCGACTTGCCGCTACCATTGAGCCCCGTGATGGCATTAAAGCGAGGGTCGAACCCG
CTGATGACTGTGCGCGTCGCGTACGACTTGAACCCGTCGAGGATGATCTCTTCAATGTGCATGAGCGACTGGAAACGAGGGGTTGGTGGTTATACCTTGG
AATGGAGTAGAGCTAGACGTCGGAAGTGGTTTGGTGTGGACTGGTGGAATGTGGAGGTTGGATGTGAGGGTTTAGTTTGCAAGCTAGATCGACGCACGAA
GTACGGGTTGGAAGGAAGATGATCATTATAGCATACAAAAAGCAAGAGTGTCAGAGCTAGTGCCTAGCTATTTGCTGCGACGGGGTTCCGAAGCAGGCCA
TGGATTCTACTTTGAGCTTGACGCAAGAGGTTGCTTAGATATTCTTCTAAGCAACACTTTTAGTGGCAGTATCCCAAGTTAGCCTAAGAAAAGAGTCACA
CAAGCACTTATTGTCACGGACCCCGGACATGATCGATGTAGCTAGTGAAGAATCGAAGCCGGAAGGAACACTGCGGCATCGACATACACAACAGGTATAA
AAGACAACACGACCGCGGTTTCGTGCAACATGCGTGGTAGCAAGAACCAAGACAAAATGACTCTGGTCGCGAGTCCGTAGCTTACGTGCTTCCAACGTTA
GTATCATGCCAGTTGAGTGAGTACAACGAAGCTTCATCGACAACCCTTTCGCGCATGTGCGTAATTTGCATCGCCCGCTTGAAGGCGAACATGTGCACCC
CCACCGAGCACGCACTACGTCACGACTATATTGTGTCTCCAACAAGCACGGAGCTAGCTACAAAGACAAGATCAATCGATCAAGTTTGCGTCATTTGGCC
GTGGAGAATACCTCTCTGGACCAATCAGCTCCACAAAATGCCACGCTAGCATCGTTCGTGCTGAGCTGAGCAACTAGCTTGAGGCTGTTCTCTGCATGTT
GCTAGCTCTTCGCAAATTCGTATCCTGAACAGTTAAATGCCAGGTGGAAGTTAGCGCAGCATCAATGTGCTGAAAATTTACACCAGCTGACCAGAAGAAG
CTGTATTAACCCGGGTACGAGAGGGTATAGTAGAAGGAGCGGCATCGAACATGTAGGACTGGTAAATCGATCGAAGAGCCGCTGATTGAGGATGCCAGTT
TGATTCGGCTGTAATGTCCTATGCTCAAACCACGTTTTTTGAGTGAGCTCCAGGGCGGCAGAGTGGACGC