Description :
From Genome Similarity Track
Location :
Scaffold_1705:575- 1834
Sequence
1259 bases(100 bases per row)
GGCTGAGGGAGCCCCTGTATTTAAATATAACCTCTCTAATCCGATTGTACCATGAACCTGGTACCGCTATGTTACTTGATACACTCACCCCCCATCCGAA
ATAGTTGCCTTTTTGTCCTCGAAATGATTGTCGCACTGACGTCCTTGGGGTCTTATCATCGTCCTCGCGTCTTTTGCTTCGGTCGCCGCACTActcagct
tctcgagcagcgcatTTCCCATTTCTGCGACTTCAcaacgcgtcgtcgccgcACCTGAGAGTTGTTCTGCCGTTGTCGAGTGCGTCTGGCCCCCAgtggt
actgctgctgttccgaCGTGTAGCCTCtcgtcaagtgctgctgctgtttcctGCTCTTGCTTGTTTGCGCCAAAAACTCGCTTACCCGGGGGCCGACAAT
GACACGAACAAAACAATCGGCGCGCTTGTCGACTGGTAGCACTACACCGCGGCCAAGCCTTGCTGCCCGAGCAAGTTAGAAAACCATCCGTGATGGTGCG
ACCACCGAAAGTTGGTCTGTGTGGCTGATTACTGACCGTGCGGGAAatgtaacagggtcacacaagttagtgtggtgcacaccactatacgtatagtcgg
atacgactatacacacaCAAAATTtataatcatttcgagccgccaaagcgagcagactttggcgggcGCTTAGCGCACGATAATTGACCAGAAAGACGCA
GCTTTCTGACCAACCACGTGCCTACACGTCACGCGGACGCGTGAGGGCTACCCGTCGGCCCTCACTACGCTATAGATATTCTACAGTAGGGTTTGCTAAG
GCAGCAGGGCTGCcaatcaattcagttttctattttcagttAAAGTTCACAAGTCTTTTGTATTGCTTTAGAAATACGCGACGCCGCGTATTTctattca
ttgcatacaaactctaagcacttctacgcttcctcatttctaaaGCGCATACAgtgtatgcctggaacagaacgctgctcgccctgtttcaggAACCCCA
TCGCTTCGTGTCACCGACCTCACTAAGTACAGGGTGGAGTATATTGTTGCTCCCGGCATAGTCGAAGTTACGTATACGCCGCGATGGGTCTTAGTCGAAG
ATGGCCTTGATGAATGtctccagctcgtggatGAGTGCAGGCTTAATGCTGGCCCTCTTTCTTTTCAGGAATATGTAGCGACTCAAACCGACCCCTTTTC
GCTTACAATCGGTGATTCTACCGATGGGAGATGTGGTTTTCACGCGTTgcagcgtgctg