Description :
From Genome Similarity Track
Location :
Scaffold_957:575- 1648
Transcript NameFunction/comments
Phypl_g11810hypothetical protein PHYSODRAFT_252207

Sequence
1073 bases(100 bases per row)
AGTCTGGTCATTCTCAAATTCGCTCCTTCCGTCGCAAGCCGCCCAAGACCACCTCTCCAACGACTTCCTCGCCATGCAGCTCTTCACACCTCTCTTCGCG
ACGATTGCCCTTCTCTCTCTCGGCACCCTGGCcaaggtgcaggaggagacCAAGTCGGTTGACGACCTCTACGCGGAGGCTGTCGCCGAAGGTGGCAAGC
TTGTCCTGTATCACGGAGGTGATAGCATGATGCGCTGCAAGAAGCTTTTCAACAGCGCTTCCCGGAGATCAACTTCACGGTGATCGTCGACTACAGCAAG
TACCACGACGTGCGGATCGACAACCAGTTGGAGACCGATACGCTCGTGCCCGGCGTCGTTGCATTGCAAACGCTGCAGGATTTCACTCGCTGGGCGGACG
AAGGCAAGCTGTTGACGTTCGTTGAGGGATAGCGAGGGCGCCTGGATGGCTTACACCATCTATTCGTTTTACACAAGCTACAACTCGAGTAGTCTCGACG
GAGTCGCTGCACCCATCGCAATGGAAAATCTGACGGACTCGCAGTGGGCCGGCCAGATTGCCACGTCCTACcccaacgacgacggcgctgtgCTTTACCT
GTTCACACGCTATGTTGAGCAGTACGGCTGGGACTGGGTGGCAAACCTGGCCAACCAAAGTGTCGCCTTCCACCGCGGCTCCAACGTTGCAGATGAAgtg
gtggctgctggcgagAAAGTGATCGGTATGGGCACCGACATTGGAGGCAACGCTCCGGTTGGCAACAACACCGAGTACATCGCATGGGGCCAGCGTGCCG
CCATtctggagaaggccaagcacCCTGCTGCGGCGAAACTGTTCATGAACTGGGCTCTGTCGGAGGAGGTGCAGTCGTCGACGGTGGCGCCGAGTGTGCG
CACGGACATCAACACGGACAAGCCTTGGGATCTCCCCGAGGCCAACATGGCAGACTTCCCGCTGTTCATGGAGGAccgcgagaaggtggaggagtgGACG
CAGACGTTCACGCTCTACTTTGGTGCAGGGCGAGCCGACTCCGGGCGTCCTCGGCTTGCACCCCGGTCTGCAA