Description :
From Genome Similarity Track
Location :
scaffold_680:5749- 7296
Transcript NameFunction/comments
g9834.t1 DEAD/DEAH box RNA helicase, putative

Sequence
1547 bases(100 bases per row)
TTAGACCACCGAAAGGCAACTTTAACGCTTCAACATGGGCAAGACATTGCATTGGTCTCTCTATCAACAATGTAGCTGTTGCTATTCTTCATCTATTTCG
CAGTACCATTCTTCTTGGCAAAGAACGTCGGTGCCAGCTCCACGAGCCATTCCTTTTCGATCACAAGTACCGACCGGATGTAGTGCTTACTTGTGAACAC
CAGTTCGTTGTAGACTACCCACTTGGGCGGAGGGTTACGCATGAATAGCGATGATGACGGGTGTACCTTGACGATCTCCGACCGACCGCACATGGTCTTG
TATGCTGTCTTGGACCCTCCAAGACCCTCAGCGACGGACCGCATAGCCGTGTTCAGGAAGAAGCCGGCCACAATACTCTTACGCAACGGGTCGATGTCTG
GGAAGCTCGAGTCAATGGGCAGCTCCAGCTTCTCCAGGTACCCCTTAAGCTGCAACCGCACACTCTCCACGCGCGTCATGGCACGGTGGTTGATGTAGTG
GTCGCGGCACCATTTGTTGCGTTGCTTCGCGCCGCACTGCATGTATCCGTTGAAGACGTTCAGCAGCGTGATCTGGTCTCCTTCGTAAGCGACGAAGCGT
GCACGAGACTGTGCTGCCTCCGCCTTCTTGTCACGAGGAGAGTAGAAGATAGACTCGACAGACAGCATGGCCACGACACTTAACGCTTCTTCAGCACAAC
CCAGCTCTGTGGCCTTCAACAACATCACGGCGTACATGGGCTCCACGGGAAGACCAGCCATCTGCCGACCAAGCGTCGTCAGCTTGCCCTTGTTGTCCAG
CCCACCAAGAGCGTACAGCTTCTCAAGAGCCTTAATAAGGGATGTCTTGAGCGGCTTCTCGATAAAGTAAAAGCCCAGTACGTCGTCAATACCCATGCAC
TTCAGCTGCAGCACCACGACCTCCAGACTCACACGCTGAATATCAGGAATTGCACGTTCTGGGAGCTGCTCGAAAGTCTCCTCCGGAAACAAACGGTAGC
AAATACCAGGAGCCTCTCGACCAGCACGACCCGTACGCTGCCACGCTTGCGCCTTGGACACCGACTCGGTCTGCAGCATCTCCATACCACTCGAAGCAAC
GAACGAGCGCTGCTTGACAAGTCCCGTGTCCACGACGAAGCGGACTCCATTAATGGTAATCGAAGTTTCTGCGATATTCGTGGCGAGAATGACCTTGCGC
ACTCCTGCAGGTGCTGGCTCGAACACCTTCATCTGCTGCTCTCGTGGCATGGCGGCGAAAATGGGACACACCATGAGCTTCAAAGCATCGGCAGGCAGTG
ACCGACCGTATTCTTCTAGCAGAGTCTCCAACGTCTCGATATCTTCCTGACCCGTCAAGAACACCAGTATACTGCCATTGCTTTTCTTCTCCTCCAGATG
AATCTGCAGCACCGCAACCAACGCCGAGTCGAGGTAATCCGGCTGTGTCTTGGCAGTGTAGAACACGTCGACCTGGAACATCCGCCCGGGAATCTGAATC
ACCGACGGCTTGAAGTCCTCAAAGAACCTCTTAAACAGCGCCACATC