Description :
From Genome Similarity Track
Location :
contig_19:574785- 576472
Transcript NameFunction/comments
g4432.t1hypothetical protein

Sequence
1687 bases(100 bases per row)
GGCCGTCACGGGGTTCGCCAGCACCGTCTGGATCTGCGCCTCGATAAAGTAGCACCCGGGCTCCACCGTCATGTTCTCTCCAAGTTGCGCACACACCGGA
GCTTGGCCAGGATCTTCTTCGTCGAGCGCGTGTAGCCCACGGGGATGCCGCCGACGTCGTGCGTGTCCAGCCCATCAAGTGGCCCAGGCCGTGCGGGTAG
AAGAAGGCCGAGATCTCGTGGTCCATGAGCTCGTCCACGGTGCCGTTCTGGAACAGCCCGTACTCGAGCAGTGCTGCGTCAGCACGCGGTGCGACAGCAA
GTGCATGTCCACGTAGCTGATCCCAGGCTTGATGGCCGCCATCACCGCGTCGTGCGCCTTCAATACACCTTCGTAGACCATGCGCTGGTCCGCCGAGAAG
ACGCCGTTCACAGGCCACGAACACGTGATGTCCGACGTGTAGCCGTGCAGCTCCCCGCCCATGTCATTCAGGAAGAGATCGCCATCCTCCAGCAGCTTGT
CGTTGGGTGCTCCCGCGTGGCCATAGTGAAGCGCCGACGCATTGTGGCCGCTGCCACAGATGCACGTGTACGCGTGGAAGCGCGCGCCTCCGTTGCTGTA
CACATAGTGCAGGAAGTCGCTCTCGGCGTGGAACTCCATCTTGCCCGGCCGGATGTTCTTCATCACGTTGACGTGCGCGCGCGACGACAGCTTGTTGACG
AAGCGCAGCAGCTCCAGCTCCTTCTCCGTCTTGATCACGCGGCACTCGACCAGCACGGGGTGCAGCGTCTCCCTGTCCACCTCAAACTGGTCGATGCCCT
CGAATGTGGACGTGGTTGGTCTCCAGGCCGCTGTCCGCAAGCCTTGGACGAATATTGGAAGAACACTGTTCGTGGAACGAAGTGGGGAGGTAAAAAACCT
CAAGAATATTGTTCTCGAGGTTTTGGACCTTCGTCCGTAATATCGGTTTTTGCAGGGGAATATGCGTGTGCACTGCACAGTGGGATGTGTTCGCTTCTCG
CCGGTCTGGTTGGCAGAAATGATTTTTTCTGCGATTGGCTATTAGTCAAACGGTAATTTATTAAGATCTTGGAGAGGCGGGAGAATATTGCAGTCTTCCC
GACGATGGTGCTAACTCGCGCTCAAGCTCGCGCTCAAGCTGCTGCTCGATCTCAAGCTGCTGCTCAGGACGATGTGGAGATCGACGGCGACATCGACGAC
GGGGAGATTCACGACGCCGCTGCTGACGGAGAGATCGGCGCCGCTGGTGATGACGCGAAGAAGGACGTGGATCGGTGTATCAACACTCTGCAGAGCAAGG
AATCCCAGTCTGGTGACGACGCGGTGCGACACGAAGGTGGACCAGCCGAGCAGCCCGAAGCTTCCCAATACAGCATTGAACACAGCTTGCAGTCAGCTGT
TGATGCCATCTGCAAGACGATTAAGGAGGGTGTGCGTGAGCTGACGCCTGTAGACGAGCGCCAGAGAATCCGAACGACACGCTACGAGCCCGACTGGAGC
AACGACGGCGACAGTGGCAGCGACTCTGATGGAGATAGTGAATTCGAGATGAGGATGCTAGAGGCATGGGAGAAATCCTACCGACACGCACCACGACCTG
TCTCTCCTGTTCAACTGCCTAATAGAGAGAGTCGCCGTCCAAGCAATCTTGATGATGAGTCAAAGGTGCATGCAGCGTTGGAGAGGG