Description :
From Genome Similarity Track
Location :
Scaffold_1:574706- 578681
Sequence
3975 bases(100 bases per row)
AATCGGCACTGAGGAATGGGTATCGACTTCTGAAAACTGATAATTGAACTGCAAACACAGGTCCATCCAACAATCACTGAGACATCCATTTTCACAGTAT
CTATCACGTCCTAATGTCCCATTTTCTAAGCAGAAGCACCTCAAAAGTAGCGGACAATTTAAGAGACATATTTTAAGCTTGATCGTAGTATTGATCGTTG
CATATATTTTTTGTGGTTAGGGTATAAAATTCTGTCAGGTACATATGCAACCTTAACCGGTTATGTATTTATAGAGCCCATTAGTTAATTGATTCATATA
AAACACATGGGATCAAGAAGAACATTTATTTAAAGAGATATTTCATCACAAATTTTAAGGTGGGTGATTCCCTTAAATTGTCCCATGTCTCTTAAATTGG
AAATCTACGTTACTAGTACGTAGGCAAGATGTCACGTGCGAGTAAACAGGCACTGAATCTGGGCGTGTAATGCGCGAGTCAGGTACAAATTATTATTCGC
TTGAACATCTTTATGCTAATATTTGTATTCGTATGCGTATTTTTATTCATCCCCTTTGCATACAACCTGCAGATTGTGCATGTGTACTGACTGTATGTAG
TACATGCAGGAAAGGCTCAGCGATTTCTCAATGCGTACTGCACAACGGGTCACGAAACTCTCGATTCCTCATAACAACAACCAATACTATCAACAACACC
TTATTCCATGTCGCCTGAATCAACAGCTGTAGAGAACGACAACTTGGAACTTGCCAAATTCGTGGTATTTCAAGAACCAGCCCGTACATGCGGCTAAGAT
GCCTCATGCCAGAGAGAGCTGCGAATGCACAGACTATGCTGCATAGGCTGACCTAGTAATGGACTATCTTGTAGTACGAGTTGTATTGCTGTAAGTATTA
CACTGCTCGAGAAAGAGTCATCAAAGAATTTCGATATAATTAGGAAGCGTGTCAGTACTGTACAGAGAACCCCGGAAAAGTCCGACCCCCCCAAAATATC
CGACCACCTGTCTAAATTGATGTAATTTTATTCATTGTCGACGCACCTTTGAAATTGAATTTATCCATCACGAAGCCAATCACAAAGCAGTATTAATGCA
AGTTTATGATTGGCCTATCCAATTTCAAAATTTGAAACGCTTCACTTGACATCATGCCGACGCGACACCGCAAGAAGTCATACTCCATCGACGAAAAGCG
AAAGCTCCTGGCTATGTTCGAAGCCACTGTAACGAGCCATCGCAAGTTCTGTGCGGAGCATGGAATACCTCGAAGTACGTGGATCGACTGGCAAAAGCGC
CGCACAGAACTTGCGACGACTCGACGCAACGCCAAGCGCCCAACGTTGGGTGGAAAAAGCAATTCCGCGTCCCCACATTGTAGTTGTGTAAATAATAGAT
ACTGTGTTGTGATCTTAATTATGTGCTCGGTAGGAGTGTTCTCTGGATAACCCCCCGTCGTGAATCCAATAGATTTCTGTAGTAGGTGATTAAAAATAAC
AATGTTGAATATTTTTGTCATGTTGTATATCACTTGACAAAATATATCCCTCGGTGGGATTTGAACCCGGGGCACCTGCATTTCAGACTGTGTACGTAGT
GCATTTAGCTGCAGGATACATGAAAAGGGGGGGCAAAAAGTGGATTTCGAGGTGGTGTCATCACCAGGGAGAACGATCGTCCCTATAGCGTCGCAAAGAA
ATGACTAACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN