Description :
From Genome Similarity Track
Location :
Scaffold_1195:5747- 8922
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1195-exonerate_est2genome-gene-0.0Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_1195-fgenesh-gene-0.3Transcription factor E(Y)2

Sequence
3175 bases(100 bases per row)
GAGGTGAAGATGAATTGATGGCGTTGGTTTTTATCCGTTTCTGTGGACGCGTCATTGTCTTGGTGGCTGAATGCAGATGCTCCATCCGTTTGAATTCGCC
CTTGAACTTTCGAGTGAGAAACGGAGCAAAGCGCTCGTCGTTCCACATGTGCAAGCTCGTGAGAACGTAGACATGCATGGCGCTTCGGTCGACAATTAGC
CCCGTCGTGATTATGCGCTCCGCTCCCGTTGGTGAAGACGACATGATGGTGACTCAGACAACAGAGTTGCGCAACTTTGACTGAAGCTGCGACTCAATGG
GCACTAAGCTCGGTTTGGACCACAACAAATCTTCCGTTTTCCTCACCGCCTTCGCAGAAGGCATGTCCACCAGTACGCGAAGTTCTTTCGTGTCGTTCAG
CACCAGGTAGCTGACAGATATCGCCAGATCAGAAGCTAAATGCTCAATGCACGCTCGCGCCAACTCAATGAACATTAAAAAAAGTGTAAGTGGGTCCATG
CTCTACGAGCTCAGCAATGATATCGATCCAATACTGGTACTCTGTGAGTTATGGCTGAGGGGTAATGCTGACACTTGTTGGGGACAGTTTCCTTTTTCTC
TAGTCCGAATCTGTATTTATGATGAATGTGCCAACCCGTCACGTGGGGGTTCTTTTGCTCATGTGAGAGCAGCAAGGGAAGGAAGGAAGGGAAATCAGAT
GGTTACAGTGACGTTTGTGTTGTTGGCGTGATGCGGACGAACCCCTACCTAAAGATCAACAAGAATGCCAGGGTAAGTGCGATTGCCACACGAATGTCAT
AGGCGCCAATAGCGTACTGTAGTTTGCCTAACTGCATGTAAGCAAGGCACTCAATTGAACAATCACAACTGATGAGACTTTTGTGGCAACGATACGAAAC
CAAGTTGGCGTTGGCGACAAATACAGCAGCACATCAACATCAACTTCAATGTTGTTGTTCCGAATGTCCCTTAGAACAAGTGGGCTAAATTAGGGACGTT
TCCTTTCGCGAAAAGGTTTTCCTGTCATTTCAACCAGCAACACAAGGCCAGAGGTTGGCAATTAACAGTCGACAAGAAGAGCTCAGCGCATGCTCAGCGG
TAGTTGTCTCTTCACCTCGCTTGACTGGATAGAGCGTGAGTTCCGCCGACTCGAATATTGAATTCGATCTGTAGTTGTATTCTTGAGCACATTTTTAAGG
TTTTCGTAACTTAAGAACTGCGGGCGAGATCAGTGTGATGTGGCAGAGTGAGGCTCTAAGTGGAGCTTCCGAAAGGTATCTAAACTACAAACGATAGTGA
AGAACCAGGACTGTGCGACGAGAGAGCTCAAGCAACCAAGACAGCAGAAGGGCGGTGATTGACGAAGCTCGCGTGACGAGCCGCTCAAGCTACGCAGTTG
AGACAGTATGCGGAGGAAAGACTTTGAACGGGCTAAGTAGCTGTGCTTTGTTGTTGTGACGCACATACTGGCCTCGAATGTGTGGCAGGGTCGCATCATT
AGAGATGACCATCATCAAGCTCAGTCTACACAGCAGCCTTTACAGTGATAACGAGGCTTCAAGATAGCTGTTGAGGGTCGATCGAGACTTTCTCAAATCA
GTCGTTCGAGTGCATCAAGGTTGGAGTGCATACTACGGAGATCGAGAAATGTTGATCAGTTCTTACAAGTCGTCAATTTACGTTATTACCACGAGCGCTG
GCATACCTTTGCTAGTTTGCTCGCAATTATATTCAATATGGACGAGACGCGTGACTTGTCAGCACATATGTTTTATATCACTCGTCAGAATGGATGGTTT
TATAAATTATCGAATTGTTCGTGGCGATGCTGCCAGCCGTGTCTTATATGACGAGCATTGGGGCGCGGATTGCGCGCTCATTCATTCGCTCCATTGCGAG
TCTCTCTGCAGCTCTCTATCATCCTGGATGGCTATTACGCTGATTTCTCGATAAACGCTTTGATTTTCTCGAGTATGTCGGTCTTCACGGATTCCGGTAC
CGACACTTTATCAATATACAAAGCATCTGAATCAACGGAATCACAACGAAGCAGCAATTTATAATGATGGGTGCGTACCTCTTCCTCTCGGCGTGATCTC
CTCCACGAGATCCTCCACAGTCACTTGGTCGATGCCTTTGTTCCGGATCACCTCTATACACAATAAACTCACCGCACTCAGTGCACACACCCTCTCTCCG
TTTTGTATCCTATTCTAAATAATGAAGCGCAGACCTTTGCAGTGCTGCTTCATCTCGTCGCGCCACCCGCACTCGATGAGCTTGTGACGCAAAAGCTCCT
TCAGACGCTCCTTCTCGCCGCTCTCGACCAGTTTCTGGCTGATGCGCTCTTTCACCTGCTCGTCGCGGCGCTTGCGGTCGGCGAACGATCTACAAAGAGA
GAGAGGCACGTGCGAGCACATACAAAGGAGTTGTGTGAGCAACAGAGTGGGGGGGCATATACAATGCATGTATGCATGTGCTTCTTGTAAACAACAGAGA
GAGAGAGGATGGTTCATTCACGCACTCTTCCATGGTGGTGTTTCTGTTTGGCTCTTTGGCGCAACTAAAAGCAGTAGGAGCGGTCAAAAGGTGAGGTCGC
TGCACCACACTAAATCAGGATACACTTTAAGAAAACTGCCTGCTTAGGTTTACATCTCACCCAACAGCATTTTTCTTGTCTACTTATCATGAGTCTCGTT
TATTTGTAACTATTATACGTAAAACCAATAACCTATCAAACAGAATATACCCTTATTGTGTCGTTTTGCGGCTTTCATGCGTACACGTGTTGCTCAATCG
GAGTGGGTTGCGTCTACCCCCATGTCGCTCCTGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCACGATCCGACGACCCAACAGAGC
GAGCGTCACAATCAAACGACCGAAGTTCCATTCTCCATTCCACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGATCAACGTTC
CCTTACTGGACGTGTGGGTGTTCTATCTACTGCAAGTCCATACAAACTGCAATATAAGTACAAGAGATCTCCCCCAACAAACTAGTTTCGTATCCGTCGT
GCGCTTGTTTTGCTGTAAGTATCGTCGTGTGTTGAGACTTTTTGTTTGCTTTTCGCCACCGACCGCCCCCCTCCC