Description :
From Genome Similarity Track
Location :
Scaffold_14:574667- 576161
Sequence
1494 bases(100 bases per row)
GCCAGCTAGTCAATCTCTGGCTGATACCGCGCAAGCCAAGGGATGCCCAGGATGCAGTCAAACGCGTACTTCATCTCGATCACCAAGAAGTCGTCCTTGC
TACGAAAGCCGTCGAGCGTGTACGACACGGACACGTCACGCCGCGCAACGCGGCGAGCCTTACCATCGGCGAGTTTGACTTGAATCTCACCTGAACCATT
CCGGACGCGGACGTACTTGGGTAGTACCGACAAACACGACGCGCGAAAGAAGTTGTTGGTCGCTCCTAAGTCAAGGAGCGCGCGCAGTGGTCGCCGGGCA
CCGGCGACGTGGAGGCTGACGATGATCAGTCCCGAGTCGCCCGGCGTAGTGGTAGCATTGGTGTGTGCTTGGAGCACGGGAGGGCTCGAAGGCTGGGCTG
CCACCGGAGGGCCCGGTCCTTCGTCAAAGCCAGTAGGGCGCCCCGCACCTACTGGTCCTGGTCGTTTTTTGAATAAACGACCGAGGAATGGTCCGCATCG
GCGTGAGCGACGACGGGAGCTGGCGTGCGGCACTCCGCCGTGCGATGTCCTTTCGTCCCACAGCGGAAGCAAACGAGGGAGCGACTGCTTCGTCCAGCGC
TACCGCGGTAGGACCCGCGACGTCGATCGCTCGACGCGTTGATGGCGTCGATCTCCATGGGCTCGGGGGTATAACTCTCGGGCTTCCGCAGGTATGGCTG
CGGCGTACGATGCAGCGACCGTGTAATCCTCGCGAATCGCGAGTGCAAATGCCTCCTCGAGAGAGGAGGGCTCAGCTCTAGTGAGGCAGTAGCGGGTCAT
GCCCTCGCGCACGCCGAACACAAATACGTGGCCTTGCGAGACCATGTCGATTGGCTTGGTCACGATGCATGAAGCCAGATGTCGCGTCTTCTGGTCGTAA
TCACGCATGGACATCTGCCCTTGCCGAAGAGCGAAAAACTCTGCGCGAGCGCGAGACTCTTCTTGCGGGGGCTCGAACGCGAGGCGCAAGTCGCTCTGTA
GAGCTTCTAGAGTCGAGAAAGCCTCGGGGTCGACAACCCGCATCCCAAGGGCCTATTCTTTGGCCTTCCCGGTTAACCGGGAGAGGAGGAAGTTCATCTT
GGCGGATGACGCCTCGATGCGATGCTAGGTGATAGCGATGTCAATCTCGCGGAACCACCGGTTTAGCGAGAGCCGGTTTTTACTGGCGCCAGAATATGTA
GACGTCTCCATTTTGACGACATCATACTGGGATGAACGCGAGGGAGTTGACACCCGCCGATTCGCATCGGCGAGCTTGCGTTCCATGAACGCTTGTGCTA
CAAGACGTTGCTGGTCGGGCGTCGCTGAGCTCAGCAGCGGTGCGACAACGGCATCTCCGGACACCGCCACGAGGCGGTGAAGCGCTTCCCACTCCACGCG
AGTGAGATGGGGGAATGCAGCATGCTCCAGGGTTGTCCCGGCGATCTGGACTTGGCTCATCGTAGACTTGGTCGTTGGAAGGACTACAAAGTGC