Description :
From Genome Similarity Track
Location :
contig_51:57458- 62551
Transcript NameFunction/comments
g8602.t1hypothetical protein

Sequence
5093 bases(100 bases per row)
TGAAACTGGAGCCATAGCTCGATGAGGATGAAAGGTAATAGTCAGACGGTGATGATGAGGCTGAACGAAGCGATGGGTGCCCTGGCGGTGGTGGAGTTGT
AAGGCTAGCACTTTTTGTCGGAGACAACGTAGAGACCATCGTCGGCGCGCTGGATGAAGACGCCGCCAATTCGCAACTCTTGCGGCGCTTCTGAACGCAC
CCAATGCACACGCGCACACTTGTAGAACCCACGTCGGGGAGCGCAACATCCATTTTCGGGCAGCACTCAGAACAGCAGATCTCACCGCACAAACGGCAGT
GGTGACGACGACGCGAAAGACCAAACTTTGCATCACAAATACGGCAACCTAGACGCTCACGATTGTGCACCCAGTGAGGCGCATTCACGAGGAGTGACTG
TGATAAGCGTCGGCTTGTGAGCACCTCCTCCAGTCGTGCAATCCTGGCGCAGAGTGCCCGAAGCTTTGCTCGCCGAGACGCCATCGGCAATTGTGCTTTC
TCCAAAATCGAAGCCACAAATTGTACCTCTACGTAGCCGTCACGACCGCGAGCCTCGCGAACCATGAAACCTGTAGGCTGGAGGTCCGTTGGTTTGGAGC
CAACCTCGTCCAGCCACGGCTGGCAGTGTGGGCTGTAGCAAGATTGCAGCGTGCGTACGTACATCGGCGATGGATCAGCACTGTCGTCCCAGTCGTTCAC
CAAGAAACACTCGTAATCTAGGAGGCAGTAAGTAGTCCGCGACGCGAACATTCGACTCGACTTTTCACCAACAACCCACTTGATGCTAAGGTTTCCTTGG
TGACCCGACGTCGCCATTGCTGCGCGATAATCTTCCATGTAAGTAGGGGACAAGTACGGCCCCGAGTTCGTCCCCCTTATCGTAGAAGTCAAACCGTTTA
TGGATCGGTCGGCCTCTAGTGAATCACCGCGAGCACCTCGAGAACGTCCGGCCGTGGATTCTCGGCTGAAACCTGTAAAGGGCTGTACATCCTCTTCGCT
TTCCAAATCTGAGTCCGAATAGGAAGACTCGCTGTCGCAGTCCAGTGTTGTTGTTTGAGAAGCCATTCGCTGAGGAATGCCATTGTTCGCATTTCCACTG
GTGGTATTATTGTTGCCGCGACGCAGACGCTTTTTTTTGCGGTGGTATACGAATGCTGACGAGCTCGTGCGAACCCCCACAAGGTGTTGCATGGGCAGCT
CCATGTCCTCTCTGTCCGAGCGCACGAGTAGATCCACGACCTCCTCCAGCGACGACGGCAGCAGCGCCACACACTTGACGAGATACTGCTGCAGCACTTT
TGAAGCGAACACGTTGCCGAGTCCAGCAGCCGATGACGCGGAGTCCCAGTCCGACGCATCGTTTTCCCACGCACTCGCTCCGTTGACGCCGTTGCTGCCG
TTGCCGTTCGCAGCTGCTGGGTCTGCGCCTGAAGCCGCGGGGTCGTCTCCTCCTTCGCCGCCGTTGACGAGCGAGTTCATGGTGTTCCAGAGGAAAGTGT
TGGTACCGATGGGGCACACACGCTCCATGACACGCACTTTAATCGCGCCGCCTGTGCCCGGGTTCTCAGTGGCGGACGCCGCTGCCGCAGCCGCGCTGGC
GCTCACGGGGCTCCAGTTGACGGAATCCTTGGCGCCGAAGCCGAACAGACTGAGCGACGCACGCGCCTGCGACTCCAGGTCCTCCTCGACGGCGTGGGTC
ACGGATGCGCTCGTGAGCTGCGCCGGCTGGAGCGACAGTGCGCTGGCCATGCTCTGTGTGCTGCTCGTGGGCTTCAGCAGCCGCGCAGTGTTCCTATTGG
CCATTTGCTGGGTATACTTCGCGCTAGCGTTTCGACTTGGCACTGCGCAAGGTCTGGGTGAAAGACGGAAATGAGACTGCTGGAAGCTCCCACCGGATCC
CTTGCTGGCGAGCTCTGACGGCGGCACGCGAGGGGAAGAACTGCCGCCACAACTCCACAAGTCGCTTTCTGGCATGTGGGTCGAGCATAAACCATCGGGA
ACTGAAATACAGACTAGCCTGCGTAAACAGATAATACATGGGATGCATCTCAATGTAGCGTAGGGATAAGACAAACTGTAATATAGCATGTTACCGCCGA
TAGCCGGACGTCAAAATTCAGAACAAGATAAGTTTTGCGACGACCACATCATGATCACTTGAGCGCTTTTGTTGCAGGAATATGCCGTTGCATGTGCGGC
CGGCCGGCGAGCCCCCCCCCAAAGCACACACAGGAGGCAAAAGTCGCCTCTCAAGCTCACCTCGTTCGTTGTTGCGGTGCCGGCCATGCCGTACGACAGA
CAACAACTCTTGACTCAAGTCGAGAACCGGCTTTGCTCGATGACGCCATTGGCGAGCCGAGGTGCGAGTCTCGGCTCGGCGATACGATGGCCTCGCCTTG
CAAGAAAATCAACAGACTTGTTGGTGCAAGTGCACCGTCGTCAGTCGGTACATTATGGCTCCAGGTAGCTAGCTAACTTCACGTCGGCACAGTAAGCAAA
ACCATACCGATTCAGTACTACCGAAGCCGGCTGCATTAGGCAAACCACTTGCACATATACAACTCAATGTTCACTCACTTAGGCTTTGAATTAAAGAGCT
TCCATGAACATAAGGTCCGAGTCGCCTCCATCGCCTGCGTGTGTGTTGTTTCCTCCACTGCTATTGTTGCTGTTCTGTCCGGAACTGCTGTTGCTTCCTT
CCTGGCCCATAAAGCCGTCCATATCTAACAGATCCATGCCCGAAAAATTTGTCGGCGAGAGATCGTTTGTAAAGCTCATGAAACCCGACGATGATCCAGA
TGATGCCAGGTTGCCAGGCATCTGCAAGAGGCCACTGCTATCCATTTCCCCCATACAGCGAATCGTCCAGATTCAATGACGAGGTCTCGCCACGAGAGGT
AGCAGCCGCTTGCTGTGTCTGCTGGGGCGGCTGCGCCTTTTGCTGCTGAGATTGTGGCTGTGACTGAGACTGCTGCGGCTGGGACTGAGACTGCTGCGAT
TGAGATTGTTGTTGGGGCTGAGACTGCTGCTGAGGTTGGCGAGGTTGCTGGGATTGCTGTGAAGCACCCGGTTGGGGCTGAGCAGATTGCTGTGGCCACT
CGGACCTTGCTGAGTGTGTTGAGTTTGCTGAGCTAGTTGCTGCTTCTGCTGGGGAGTCTGCTGCGCTCCAGAATTCTGGCTATTCTGCTGCGCATTCGGC
ATATTAGCTTGGCTTGACTGCGCCGAGTGGGCCTTCTGGTGTTGCTGCATCATGTGCTGTTGCTGCATCATTTGCTGCTGACGCGCTTGCGCCTGCATCC
GCTGTTGCTGCTGCTGCATCTGTTGAGCGCGCTGCTGCATGAGATACTGCTGCTGCTTCTGCTGCAACGACATATTCTGCTGTTGCTGCTGCTGCTGTTG
TTGTTGCTGCTGGTTGGACTGGCCTTGCTGCTGGTGCTGCATGTGCATAGCCCCATTGGGTCCACCAGAAGTGTTGACCGTAGTCCCAGCGGGACCGGCA
GATGCGGGAGGGCCAACGCTAGCAGCGGGGTTCCCTACCGTGGAAGGGTTCATCCCCGCCGGGTTGGGACCGCTCTCACTGCCGGCATTCGGAGTGAAGC
TGCGCTTGTCCGTCTCCGTACGCAGCTTCTTTAAATACGGGTTCACGATTTTTACGATGTACTTGTACACCTTGTCCAACTCCTCGATCTTGCGCGGGGC
ATGCGTCGTCTTGTCCTCGTTCAGAATGCTTGCACACAGCTGCACGTAGCTGAGAAGATACCGCAACTTCTTCTTTTGCTCTGTCTCGTCGTGGCCCTTC
ATATGATCCACGTACTTCTTAAACGCACTGTGCACTTTCTCAACATCATCATGATACTTGGACTTGAGCGCTGCGTGTTGGCGCCAGTACTCCGCGGTCA
TATCAGCAGGAATCCGCCCTCTGGTTTTGTTGTCCGGGGTGTGGTATTCGACCCGTTGGGTGCCGCAGGGTTCGCAGGCGCACCTCCAGCACTCATCGCC
ACAGGCTTACCCGGCTGAGGCTGCTGGGCACTGGCAGGACCGCCAAACTGCGGGTGGCCAGGATATCCTCCAACCTGGGTCCCATTCGCACCTGTAGCGC
CTGTGCGCTGGTTTAGGTTGAGCGTGTTGTAGTACGAGAAGTCCAGCCTAGACAGCATGCCCTGGTTAGGCAGCGTTTGCGCCGCCATCACCGCGTTCAT
GTCAGTCTGTTGCGCGCGCAGAGACTTGAGGCGAGTGAAAATCTTGCTGATATACTCTTCCTGCGTCCGCGACTCCTTATAGAGCGTCAGCTCATACCAT
GACACGTTCATCCAGAGCTTGATACCCGGTACGGGGTCGGCGGACACGCGCACCATTTCGTTGTAGCTGGAGGGGATAGCAACGCTACGGTCAGAACGGA
GAGCAATCGAACACAAAACAAGCATTTGTCACACGTACATCTTGGCGATGAGGTTCGCGCGGTGTTCGCGCGTGAGCTGGATTCGCCAGTCGGCGCCAGC
GCTGCTCTGGGCACCAGCCGCCTGCATGCCTGCGCCCGCGGCGGCAGTGGACGGGTTCATGGCGTTGGGGTTCATCTTCATGGCCATGGAGCCCATGTTC
ATCTGGTTCATGTTCATCATCATCTGCTGCGGCTGCTGCTGCTGCTGCTGGGAGACGCCGTAGGCGTTCATGGCCATTCCGTTCATACCCATGGCCATAG
CCTGCGGGTTCGCGCCGTTCGCGCCGGCCATGGCCATCGACATGGCATGGACATGCCACCCTGCATGCCCATCGCGTTCACGGCGTGCGGGTCCATCGGG
CGTCGAAGACGAGGACGAGAGCGGAAATGGAGGCTGTCACTTTCCGCGCGCTCGGGCTCCGTTCAAATGGCCCAAGTCGGCCGTTGCGTCGCTCCCGTCG
CGTGGGCCACACCAAAACCGGTCGAAATAGCGGCCGTTCGTTTCTCTGGCGCGCTGATTGGCCAAAGCCGGCACGATCCCACTCTCTGAACGTGGTACAC
TGTACCGCGTTCAGAGCCGAGGTCGTCTGCGTCCGAGCACCCAAATGTACACATTTTTATATGTTCATACGGGTGACACCCCTCCTTTCATCA