Description :
From Genome Similarity Track
Location :
Scaffold_19:57448- 59517
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_19-fgenesh-gene-0.8Rho GTPase-activating protein gacA
Pytir_DAOMBR486maker-pir_contig_19-fgenesh-gene-0.28RWP-RK domain-containing protein

Sequence
2069 bases(100 bases per row)
ATCAGCTTCCCGTTCAAGACGCGACAAGAGCTCCACATAACGTACAACGTGAAGCATGCGCGGTACGAGGGACTTCCGGCAGCGTGGAGAGTCCTGAACC
ACCAATTTGGACTGCCACTGGAGGCAGTCCCAAAGCGACAGGTCGATGGCTACGAGTCCAAAATCCCTGCAGTCCTGCAGATGATGAAAGAGTACCTGTT
GGCAAACAATGGCACTACGTTGGAAGGCATTTTTCGACTCGCGCCTGACAAAGACCAGTGCAACACCGTGAAAGAAGCGATCAACAACGGGACTTTTAGC
GGCTGCACTGATGTGCACATTATCGCCAATCTGATCAAGGTATATCCAAAGAGTGCAGTTATGGATACTCAGGGTGGATTGCTCATTTGGAGGGATACGT
TCATTGTTTCGTAGGTTTGGTTTCGAGAGATCCCGCAGAGCTTGTTCAACATCGTCCCAGTGAAGCACATCTACTCTGTGTGCACGCTACAGGTGATGGA
TCATCCCTCAATTTCTCACAAGAAATGGTAGCACCATCTGATGCAATCGGTTTGTTTTCTAGGACCCGCAACAAGCTTTGGACAAGTTGGATGAGTTCCC
TCCCCTATACAAGAGCGTCGTGCTGTGGCTTCTCGATCTCATGGCTGAAGTTGTCCAGAACAAGGAGGTGAACAAAATGTCTGCAAGAAACATGGGTAAG
AACGGAAATGCTGAGAGCTCACGAAAGTCTCCTATCTAACGTGCCCATGTTTGTTGGTGATGCTTCTTTGGTACGTGCTCAGCGATCGTGATGTCACCGA
ATCTGTTCAGCATCTCGACGGACAACCCAATGTACGCGCTGACTATGTCGCAAAAGGTTGCTGATTACACTTTCGCGCTGCTAAGTGCGCGGTTGAAGCT
CGCGCATTCCCAAGTCGAGTGAGTAGGTAAGAACGGAAAATGAGAACACTGGTGTTGTTTGTTGGCGTATGCTACATTGTCTTTTTTTATCAAATAACTT
AGGAGAGAAGGAAGTATACAAGGCACACAAGATACATGAAGGTCATCGTCGTAGAAATACAAAAGCTGTGAAAAGTGAGAGAGGAAAAGGAAAGTCGGGA
AAAGGATTTTTAGACCAAACAGCCGAAGTCCGGAGAGATCTGCAAGAAGACGTCGTCTTCCAAAGTCTCTGCTTCGCTGTGTACTGAGCGCTGCTGCTGC
TCGCCTTCTTCGGCAAGACCGACTCCTGAAGAAGCGAGCGCTCTTCTTGCTGCCATCGTGGGCGATCGGATCATCGGGAAGAAGTCATCGTCATGAGCTG
CTGAGATTCCCTCGAGCGAGTATCCGCACGTCGGGTGGTCGTCGTCGCCGAAGTCCTCCATCGTCAAGCTGTACTCGCCGCCCTTGAAGTCGTTGAAGAA
CGGGTCGTAGGCTTCGAATGGAATAGCATTGACAGCAGAGTGAGCGGCAAACCGCACTGACACACTGGGCATCGTGGACGCATCGCTGATGGCGGAGGTG
TCCATGTAGTCACCGCCGCCATGAACCATGTTGTAGAAGAAGTGGGTGGTTGGGTTCGTCCCCATCTGCTTTCCTCGAGTAGATTTCTGAGCGCCTCGAC
CACCGCGAGGCTTGTAGCTCGATCTAGCAACCGAGCACTTGGAGTACGGACTTCCCACGCGAGACGAAGAGCTCTGCGAGCCGCACGAATCACAGTCTTC
GTCATCGTCCGAGTCGTTCTCGCCATCGTCGTCGACTTGGAACTGGGCGAGCAGGCGACCGCTAGACGGGTCAATGCCGTACGTCTCAGGCGAGAGCAAC
TTGTCAAGTTGCTTCTGGTACGCTTCGAGCTGGTTGTTTTGCTTGTCGCTGAGGGTACCTTCCTCTTTGCAGCGTGCGAGATCCTGGAGCGAGCGCTTGA
GGCTGCGCACTTTTCGGTAAGGCCAGTGGCGGATGCCGATCGCGCGACAGCGCTTCTTGAACGCCGTGGCGCGCACACCGAACTTCTCGGCGGCGACTTT
GAGCGGCAAGTGGAAGTGGAGACTCAGCGCTTCGAAAGTGCAACTGATGGGGAGCGCGAGCGCCGCATG