Description :
From Genome Similarity Track
Location :
scaffold_12:57445- 81233
Transcript NameFunction/comments
g752.t1hypothetical protein
g753.t1 conserved hypothetical protein
g754.t1hypothetical protein
g755.t1 conserved hypothetical protein
g756.t1 hypothetical protein PHYSODRAFT_469149
g757.t1hypothetical protein
g758.t1hypothetical protein
g759.t1hypothetical protein

Sequence
23788 bases(100 bases per row)
CGCCTCCCACTCACCGCGTGGGTGCAAGCGTCTTACCCGAGGAGCCCTCGTGCCATGCTTCGTGCTGCGGCAATGGCCAAGATGGAACCCAATTTTGAAG
CCCATGGATGGATGCACCGTAACCCGCTTACCCCACCCAAGGCGGAACCTGTTTCCATTCCGTCGCCACCGTCCAGAGTGCTGCCACCGATTGCCACTGC
CGTAGCACGATCGGGAGAAGGACTGCAAAGCTCCTGGCAGGACACACGGCGAGGACCCTTCCTTGCCACTCGCGCCAACATTTAAGACCGACCGATCATC
TTCATCAACGTAAGTAAGTAGCAAAGTACCTAAAGTCATAAAGTGAATAATTTCTAAGCGGAAGAGACCACCGAATGTTCCGTTTTCAATCCATACGAAA
GCCAATATCGTCCTCCCCATAAGAAACGTAGCCGGTGTTCCTAGAAACCTTCAATTGCACTTGTGGACTGTGAATCAGTGGCATTGCGCCACTAAAGTCT
TGCTCCATTGATGTGAGTGACCAATGCCGAATTGTCGCGCGCGCCACCGGACATGTTTCGTTGCTTGTCATCACATGAATTAAATATCCACCGTTCACTA
ACTACCGGTATACTTGGTATCGTTTTAGACGCCGGCGCTATAAGCACATTGAAGTGGCAAGATAATTTCGCTGCTTGCCGACGGCCAGTGACAATTCGGG
TCGAGTGGATTCGGATGCTGCCCCGTCCCGCCGCCACTGGCGGGCGGACTTCCGGCATCAACACGCCGCACGCGTGCGTCCATAGTCAGGCATAAATGTG
AGGCATGGCTTGGTTTACCCGACGACGCAGCTTCCTCTGATCACTGCCAGCAATTTCTGTCACAAATGGCTTGCACAACTTTGGTAACCACGCACGTGAC
TCTCCAAATCGAAGTGCCTTTTGCCCGCTCAAATCCAGTCATCAGCGCAGAGACGCATCGACAGCACCGGCCGGTGCTCCCTGCAGTCTTTTGGCGCTCC
AAGTGCCGAAGGAGGTGGCACCGGCAAGGCAGTCACTTCACTTGAATTGCCCACTCGGATTTTCTGAGCCATCCCTTGAAATTCAAGCCAAAATCCACAC
TCGACTGGCGTTCACTTGCTTTCACTATTGAACTGAGATCCCATTTATGCGCTTCCATCTGCTCATCCAAATTCACCCATGTAGCCATCCGATCCGATTT
GCGCAGGTGGGCGCCGGTATCTTCCGTGCGTGGCTCGAGTCCGGCCATTCGCGCATTTGCCTCCCGTTCGACACACTGCTCGACATGATGGCCACACGCG
CCGGCGCCCCCACTACCTCCACGTCTCCTACGTCGGATATTGCACAGGAACAGCAGGTGCACGACCCGGAGAGTATATGCCGCTACCCGAGCAAGAAGTG
CTGGAATGCGCGCGCGCTTAAGCGCAACGGCGAACTTCACAACCTGTGCGACTTCCACCGCCAGAAGGCCAACAAGAACCAACGCCGTCTCGAACTGAAG
CGCAAAGCCCGTGCACAGGTGTCCGCAGACGCGGAGCCTTCAGGAAAGAGACTGCGTGCGCACAAGAAGCCACGCCAGCGCACGCGCCGTGCTCCGCTCA
GCGCCCATTTAGCCATGAAGGAGGAGCTGCGTGCTAAGCAGCAGGCAAATGAGATCAGTAGGAACAACGCGACCGCAGCTGTAGCCACTTCCACGGGGCT
CACCAGTTGGTTCCTTCAGGATCTGGTGCTGCTAGACGGCGTCTACGACCGGAACGGTTTCCAGGTGAAGGAGGAGCAGCCCTTGGCCCCTGCTCCAGTA
CTGCAGACACCCCCCGTTGAGCTGCAGCGTCTCCCTGAAGCGGTGGACGAGGAAGCTCTGGATCGCATCTTACAGGACGACGCCGCCGCTGTCTGCAAGA
GCTTGGAATCGATTTCGGGAATGGAAGCGCTGGCCTCATTGCCTGAGGGCAAGACGTCCCCCGTGGACGTCGGAGAGAGCTGGGACAACCTGGATTTCAG
TGACTACTGGGTCGCACCGATGCCGGCGGAGCAGCCGTCAAACTTGAGCTTCGACGCTTCTGCCTTCGCCGTGGATGAAGATGTGTTCGTTGCGGACGTG
TGAGCTGACACTGCCCATTCCTATTTATTTTGTACAAATTTAGGAAGCACAAGTCAAATAAATGCGCATCCAAACTACGCTGTAGCCTTGCCCCTGCATT
TGGTTGGTATCTGTCCGTCTCGCCGGGCCATCAATGGCTGGACACTGACGGCAGCAAATGTCGCCGACGATGGAAATATTGAACTGCCAGAACTCCGCTG
TTGGCATTATAAGAAAACACAGCAAGTCTAGCCTAAAAATAAGGCTGACTGTGCTGTGTGTGCAGATGAATAGATGTCCTTCTTCCTCTTTTTGAAAGAA
CAACAACAGGCTCGTGATTGAATAAGCAACATGCCGAATATTCGAGGGACAGCGGGTGCGACGATCAATATGCCAGGTTTGATCATCGGCTGTGTGTTGG
CTGGGCTGCTCATCTTAGGCTTCCTCCAGCAGCACATGCAAAAGCGACAGAGGAGAACAAGTACGTACATGTGAGCTGCATTTCTAGGCAAAATACCAAG
TAGTGTGACTCTTCTGCGCTGTAGGATATCACCCTCCGCTACAAGTTCAACAGTCAAGCACAGGCGTGCTGGAGCAGATTGGGAAGAGAAAAGAGGACCT
CCGTCGATACATTGGCAAGCTCAAAGAACAGCTTGCCGCTCGTGAAAATCAACTACAGTATCACGACGAACTCGAAGAGATTGTAACCTCTCGGGTGGAA
ACAAGTCGTCGTGATGAACAGGAGTGGACAAGGCTCATGAAAGCAGGCAAGAAGCTCCATGGTGACAACTGGAATGCCTCCAGCGGGGACGAACCTTCAC
TTGGGTAAAGAGAGGTAGCTCTCACATGTGCTACCGGATTATCTCACTCACACGTTGATGACCATTAGGGAGCTAATGGAGCTGCATAAGGAGGAGCTGC
TTGAGTACAAGCGATCACTTCAAAATCGACCAGACTCGATCCGCGGGCCTTCGGCTGTTCGACGCCCATCAAAATTTAACCTTCCACTTTTGAAGCTGCA
ATCCATAGCCCCACTTCAAAGTGCCTCCCGTGGCACCGGTGTGAAAATGGAAACGAATAATGAACCAAAGTCCATTCCACCTCAGTGGCAATCCACTCGC
GCCAAGGCGGGGTCTCAGCTTTCAGCGGCAGTTCCTGCAGCCCATCCAGATGGATCTGCGGTATCACCACAAAAGATGGTTGTGCCACCACTAGACTTCA
GCCGGTTGCCAGGAGGGCCAACGATTGGCGTACCTCCTACTGAAGAACCGGACGAACCTGCACAGAAGCAAAAGAGGAAGAGCTTCGAGGCCACGTTCCA
ACGGCAGACGCGACTAGCAGCTATGCTTCGAAAGAAGAAGTAGATTCCATAGTAGGTCAAACCAATAAAACACAAAAACGAAGCGTAAGGGATTACGAGG
TGAACAAATACCCTAACGAACCGTGGAAAGGTGGGGGTCGAAGTTCTGCGTTGTCTGGATGCGGGCAAATACATGACAAAGCCACTTGTGAACGCAAGTC
AATACTACCCTTGTACGTCCATCATCAATCACGCATCCGTTTTGGTCTTCTTGCTGGGAGGCCGTCGAGACTTCTTGGAGGATTTAGGCGTCGAAATCGG
CTCGCGACTACCCTCTGGCACCTTCTCCAGCACAAACTTCTCCAGGTCACGGAACGTCTTGTTGTCAATGTGGTCGACGACAATATCCAGCTCGTCTGGC
GAGCTTTTGTCGAGCGCCTTGGGGCACTGCTCCTCGAGAAGCTGTACAATCGCGCCCAGGTCTTTGGGGTCAACCTTGTAGATATTCTGGCTGAAGTGGA
CCTTCTCTTCAAGACTTGGGGAGCTGTTTAGCAGCACAAAAACGTAAAAAAAAATATTAGAAAATACCAATTATCGTAGCTCTTCAATAATGCACCGTAC
GGAATACTCTTGTCTGCCTTGGGTACCGGACCCACATCGAGCTTCATGGTCTTAACGCGGTCCTCAAACTTCTTCGAGAGCTCGTCCGCCAGCAGATACA
AGTCGGAGCCGTCCTGGTTGTAAAGCTTGCAGTTACTCCAGACCAGACGCATGTCACGTGCAAACTCCACCGGCTTTTTGTACTCGTTCTTGCTCAGTTT
GCTGCGGATGGTGCCTAGGTCCATAGGCTCCTTGACCACCTGCAGATAGTCGTACAGCCCCCATTCCTCCCAGTTGACACGCTCGCGGAACGGCTCTGCA
GTTCACACCAGGAGCTTCAGCGTATTGCCACCAGTGTATTAGTCAGTACATATTTACCCACCGCAACTGTCGAGCTTGAAGAAATGCTCTGCGACGTCAG
TACACTTCTTTCTGTTCTCGGGGTCCATTGGCGCTCTTTAAAAGGGAATTTAACGATGACAGAGAGCGTGGATCTGCCCAAAAATGGTATGAACAGGTAG
GTGAGATGGAGAACTATGAAATTCACGTGCCATATCAAGCGAACGAGCGCTGGGGGGAGCGCACGTACAAGCTGAACAGGCAGCAGATGCATCCTCACCT
TTCAAGCCCCGGCGTTTGTATGGGAGTGAGCGTATCAACTCTGAAAGGGATATGTGGTACACAAAAGTATTGTGTTTTGTGTAGCCATTTCTAAATTACG
CTGGGTGCACAAAATTATTGTGTATTGTGTAGCCATTTCTAATTTTATGCTACCAAACCCGAAAAGACCAAGCATGTACGTCTGAGGGCCGAGCAATATG
GGTAACCTTTGAAGCGTTAATTCAATGCGTTGATGCTTGTCAGGCTGTCGAAGAGGGTGAGTTGGCGGGAACAACTTAACCATGAGCTTCCGGAAGTGCA
GGCCAATTTGAGACGGATTCTGCAGTTGTCGGAGGTGGCACGATGCAAAGCTGACTACGAGTTCCTCGACAAATTCAGTGAGTTCTACTCCAACATTTGC
TGAACTGCATTTGACGCTGAATTGGGTCAATTGCGTGTTCTAGTCCAACGAGTCAAATACTTCCGCGATCTGCCGGCCAGAGACCGACTACGCTTCTTAA
AAGCGGCCAAAGGCATCGAGCTCGACGATGGAGACGCTCTGTTCCGAATAGGCGACCGCGCGGATGCCTTTTACTGTATCATGTACGGGACAATGAGTGT
GGTGATGGACTTCTCGCGCATGGCAGCCCCCACGCTGAACGAGTTCGAGGAGATCATGAATCGCGCCCGCGTGCACTCGAGCTTCCTGAATCCAGGCGGG
AAGCTGGATATGTCGCACGATGCTACTTACGTCGTCCGAACCATGAAGCCTTTGGAGGTCTTTGGAGATGTCGGTTTGCTTCTAGAAGAGCAGCAACGGA
CAGCTTCAGTTGTGGCCACAGAGACGACACTGCTCATGCAAATTGATCGTGATACGTTCATGGCGCTACGTGCGTGCAATCTATCGCGTGAACTCCGGCA
CGTATTGGTCTTTCAGTACCAGTGATCCTATTTTGCTAGTTAACCGTAGTTGTGTTGGATTGCAGGGAGAAAATGACGTTCCTAGCAGGTGTGGCGTGCT
TGGATCATTGGGAAGACGAAGGCATCCTGAAGCTATGCGACCGCATGGAGAAGATCCAGCATACTTACAACGACGTTATCGTTGCTGAAGGCGAACCTGC
AAGTAAGACTGATGCTTGTTGTTTCGATTTGATCGGTATTATCCTCACTTTGCGTGAAGATTATTTCTACTTTATAAAACAGGGTGAATGTAGACTGGTC
AAGCGCTATTCGGTCCTTGAGCAAAGAGCAATGCAACACGACCGCAAGCAGCCTTGCTTCGTTGAAATGTCCACAATTTGCAGGTAAAAGGAAATGCTTT
TGCCGTACAATTCGCAGCACTGACAGTGTTCACTACGTTCCGAAAAGCCAGCACTATTTCGGCTTCTACGAAGCTATCCTCAGTGTGACTAACGCGGTGT
TTTCCGTGCTGGTTTCGTCGCCTACTGCTGTCCTGTATCGCGTCGACCGTGTAGATTTCCGACAACTTATACTGAAGGATGCGACTACGGAGCAAATGTT
GCGCCAGGAAGTTCTTGGACTGTCGGCTCGCGCCGACACCAGGAGCGTTCTGCGGGACTTGAAGCGGGAAGCGAAATGGAACCAGTACAAACACGAGTTG
GTGGATTCGGTGCTCACTAGACACGATGAAGAGCACGTTCCCATCATGGGACCTCGGCCAGATCTCGGTGGCTATCGATCACGTGAACCAGATATTTTCT
TACCAAAGCTACCGACTTCACCTAGAGCTGCTCATATTTCTCACGCAGAACACGGAGTTCCAGGCGTCTCTTCTGGCCAGCTCCGTAGAGCGCAGAAACC
ACCAATTGACAATCCCAAGCCGTCCCCGCGTCGTTCACGTGGAACTGATGGCAGTTGGCTCAGTGTAAGTGCCTTTTGAGTTGGGCTCATTTGCAATTGA
ACGGCTAACGCTTTTTGGTTTCTGGTAAAACGTAGTGGGCCCGACAGCGAGCTGGAAACGACAATTCGAGTCGGGATGCCGCTGACAACAAGCATGAGCA
GGTAACTGGTGAATCTGCTAGCAACCCTGTCGACACCCCATAGCATTCGGTTAACGGCAAACTTGTAACGCGTGACTCTTTGCAGGCGGTTGGTAGCAAC
GTCCAGTGGGGCAAAGCTTCACAGATCATGGGAGGGCTACGCAACGACGAGGACAAAGTCTCGAATGTCATTGTGGAGCTCTTCAAGACAAAAGGATCTT
GAGCACTAGGAATTTGTGAATTAGTTTGCTGCATCTTCCTAATTCTTGGATGAGCGGGGTTTGGCAACGCCAGCGAGTTGCCTCAAGTACTAAACTACGC
GTTGGAACAAAATAAGTTACTACATGTACATTGGCTGGCCGCTATCAGAGACGTAGGGACTAGCAATCGTCCGTACGCCGTACCACATCGTCTAGACGTG
GAGGTTTTCCAGGTCCTCGCTGATTGTGTAGAGGTCTTCAAGGCACATCGCCGACGTCCTTCGTTCAATAGGCGACTCGGTCGAACCAGTATCATTCACT
GCCTTACTGAGAAGCGATGGGCTCGATGTCGTCGACGGTGGAGTATCAAGGATAGGCACTTCCTCTCCGCTGGTTGTGCCGTTGCTGATCGACTTCCAGT
CCGAAAGCTCGTCTTCGCCTAGATCCTTGATATCCAAGAAGGCTCGGATGGCTTTAAGCACGCGGCACTGCGAGTTGACGCAGCAACGCACTTTACGCTT
CGGTGCCGTGCGGTACACTGCCAAAAGTACCTCTACGAAATGCTGGAGTTGAGTCTGTCGTTCCCTTGCAGTCCGGATGTCATCGTCCTTGTGCATTTTG
AACTTCATCTTACGTCGCGGGAACTTGAGGGTTGAGAGTTCTTGAACCAACATAATGCACGCTCCATTACGGCAGTCACCCTGTCGTCCTTTTCCAGTGG
GAACATCCGAGACCTTACTGTCCAGCAGCAATTGCTTCCTTAAATCGCGGAACTGCGAGTAGCGCTTCTGCAGCACGAATTGCTCCTTGCCAGTATCCAC
GTGCAGCTTGAACGAGCAGTGGTTGTGCACGCGGGAGACGCCCAAGAAACGGACGCTGGTTTCCATGACTTCGTGGCCAGGGATGAAGCCGAAGCTCGAC
AGGCGCGAGGATCCGAGGTCCGACGACGACCGCTGCACTGCTGCAGGCATCGAGTTGCGTGTCCGCTGTGACTTGTTGTGTGAACGCCCGAGTGATCCGT
CAAAAGACACGGAGTGGTGCGCGAACGAGGCGTTCACGTGGCGCTCTACGAGCTGGCGCGGGTCAATGGCCAAGTCTTCCAGTCGGAGATCGGGCATGGC
TAATTGGAGCCTGGAAGTTGACAACGACGTGTGGACGGGGGTGCAAATTTGTGAATGCCACGCTGACCCCAACGACAAGGATGAGTCGGCCGCCAGGATA
AGCAGGAGAGGGACAGAGAGCGTTGGGCACAGAACTTGACCGATCAGAAACCAGCAGAGCTGGACAGCCGTCGATGCTTTGCACTTGGCATTTGTTGTCT
CGGTGACACAAGTTGCCGACAACTTGCACGTTACACACAGCCGCTTCAGAGAAACGCTGGCTGCTTGGGCTCAAGTCAAGGCTTGAATTGCACCCTCCCG
CTGCTGGTTCATGTAGATAACTGTACGCCAACGAGTTCCCAGGCGAAAAACGCATGGGATACCAGGTGGGTTAACCCGGATATAGCTTGCTTCTTGCTCT
GAGCTTAGGTGGTGAATCTCGAAGGTTCAAAGGTGCACACTTTCCGTGGAGACGTCGTCGACTTAACAGACGACGCTGGGCCACCAATCGATGCTGTGAG
CGTCCACACCAGCCGATCGCTGGAGGACGACAGACAGCAGCTTGCTCTATTCAACCTTGCGAAGCTCTCGGATGCTGTGCTTTAGCCGGCTGGTTGCTAG
CTGAGCAGAATGGTGCTGGTATTCCAGTCCCCACCTCAGCCGCGTCGGTGGTAATATACGACTTCTGACTTGCAGCCGTTGGTTGCGGGCTCCCGTGGGG
TTCACTGGTGGCTTTGAGGCCGGAGAATTGAAGCGTTGCGCTTGGGACTTTGCTAACGGAGAAACCGCCGCCACGTAAATCGCGGCGAGTACGCGCGCGT
CGTCACCGAACTAAACTGTGAACCCTTTGGCAAGGTCGGAATACCACTGAGTCTGCAAAGCGAAGCGCTCGCTTGCAGTGACAACCGCGCGCGTTTGGAT
TTGTCTATGGTCGACAGCAGTGCAGAGACTACACCGATGTAAAGCACCGTCGACGCCGACACGAGCAAGCAGCAAAAGCTACAGCGTTTAATTTCAGCAT
ATCTACCTCATGGCAGCGTCCCAGTTGCTGTGTGCATTTGAGCGAGGTTGAAGACGTTGAGACCTTGAAATCCCTTTAGAAATTCGTACGGGTTAGTGAC
AGCATCGCTGCTGATAGCGGACCTGCATCGATGAACGCCGCGTGACCACGATCGGTTCTTTTTCGGTTGAAGCGTACGAACTTCCGAAGTTCTACTACGA
AGTGTAGTGCAGGTCGACTATCCATGGATACGACTAGTGGAATATTCGACCTCAAAAGCATGGCAATAACAGTCAACAAGAAGAGAGTATGAATCGACCG
ACCATGTCACTACAACTGGGTCAAATGTAAACCAGATACATTTGTCCAGCCGCACGAAATCGGAATGACGGAATCTCCGTAGTGGTATCATGCAGACGAA
ATATTCCATCGTCCTTTCAGACAACTATGCGGCGAACTTCGCCGGGCGAAGGTTCTCAGTGAGAATTTATCACCGAAGAATCTCCGCCAGTTATACGGGG
CGCATCCAGACTACGCTAGACTTGCTTCCAGAGAAGTAAAACACGAGATACTGAAGAATGTGCCAAGTTAAAAAGCGTGTGTATTCGTCAAGTGGCTCAC
TCCTTGAATTCCAGCAGCGTCCTGGCGGTCAGCACACTCATGTCGTAGAAGGAAGACACTGCAGCACGCAGCAGTCGGATCTCCGTGGCCTCGAAGTGGC
TACAATAGCCCAGAACCATCCAATCCAGCAGGAAACAAGCACCACCAGCATTAACATCAATATAGACGGCAGCATGCATAAATCTGAAGTAGCTATACGT
ACACATGGAGATCCGTGCCCTTTACGGTGAGCGTGCGGTGAATCTTCTCCGGCTGCAGCTCCTCGTCAACCTCAAGCGTCTGCAGCACGAACTGTGCATC
CACTTCCTCGGGGAAGTGCAAGCTGACCTCGCTACAAGTAGAGCGGAATGTGTGAGTACAAAGTGATCAATGTAAAGCTTCATTCTTGCAAGGCTGGCGT
CCTAGTGGCGGCAACACGCTTACCATTCGTACGGGTGCGTTGCGCTGGTCATGGTATAATGTTTTGGTGATGTACGAACACACAGAATAAAGTGTGTAGT
CCACACCATACAAATTCAAAAAATAGCCTCATAAAATAGTCCGCCACAATAATTCGGGCAGACTATTTATTCTACACCTGTATACACTGTATACATGTAT
AATGTTTGTGCAGAATATCGTGTGGATTACATAATTTGTACGCACGCAATTTTCTGTCCAGCACAGACGTTGCTGTTGCAACATCGGCGAGGCATCCGTA
ATGACGTTGAAGAGCATTTAATGAAGACGCTCGATCCCTGTTCGTCGCCTCAATCCAATGCGTATGATACAAGGCGAAAGTAGTGCATTGTTCGCAAATG
TAAAGTGCGGCAAAGTACATGTAGTAGCGCGGACATACAACTCCGAAACCGCAAGCCGACAGAGTAGCATGGTGCCATCAAAGGTGTCGAAAAGCGCAGT
ACATTGTACACCGCAGCATGATGCTATTATTTTGCCAAGACCACAGACAAAATCTTGGCTAACGTTACTGCGAAGTAGCAGTGGATGTGCATACATGTAC
CAGTACACTGCTTTATTACATGTAAAGCTTAGCGTCTTGCTGACTGAGAATCGACAATGAAAACTCCGTGGAGACTGTCAAAAAGCGTGCCAAGCCCGTC
TCACACCCAAATCGAAGGTGACACCGAAAAAGCTTCTGGCTATTTTTCATAAGCATTCATTGGTCTAAACTTCTGAGACCTCTACAAGTCGATACTAATC
CACCAATCAGAACCGCGTTTGTAGCTGAACATGGCTCGGTCTTTCGCCGCATTCCCATCCAAAGCTCGATGGTGCGTTTTCCCCTCTGTTTTCTACGTTC
GCCGCCTCTGCATCGTCTTGCAAGCGAGTCAAAGCGGACGCAAATCAAAGCCAGTTCCGCTTCAGCAGGTCCGCCACCACGAGCTCCTTCGCCTCGTACG
CCTAATAACCGTTAAGAAGAATGGGGCTGCTGTGCTGCGCCGCCAAATGCTGCGGATGCATGGCGCTCTCGCAGCTCTGCGCGCTGCTGCTGCCTCTCGG
CATTTTGGCCGCTCTTGGCCTGCTGTTCTACACGTACGTGATCCCGTGGGGCGAGGACCAGATCCGTCAGAATTTGGGCCTCGCGTCCGACGTGGACATC
GGCAGTCTAAACACCAGCTACATCGAGAGCAACAGTTGCTCCGGCTGCGTTTTCGGCAGCAATACGCAATGGCCCACCAACACCACGGGCACACTGCACT
TCCTGGACTCCAAGGCCGGAAGCACCGCGTCGGGGGTCATTGCCACGTCCTTGGCAGGTGCAGCCGTGATCGGAGCAGGCTCCATGCTGTGGGCTTCTGT
GGTTCCCAGTGCTGCCGCAGTGCTCAGTTTCTCTGCTGGTTTCTACGAGATGACCCACATTGTGGAACAGGCCCAGTTTGCTGGCATGATCAGCCAGCTG
AGAATCGAAGGCGCGCCGACGTTTCTACTGCAGTTCTCCAAGGAGCTCTCGTGGACGAATTTTAACTTGATCAAGAGCAGCGACGACTCCAGTGGGAGTG
GCGATGATCGAAGACTGGAAGATTCCAGTTCTAGTGCGACGGGAGTTGTGGCTGCGGCCGGACAGTCCGGACCGGCGAGATATGCCGCTCTCATTGGTGT
GGATGCCGACAATCTCTTCTTCTACACGCTCGTGACGTTCGTTGTGGTGATTGCAGCGCTTCACGTGTTGTACCTTTTGGTCGTGCTGATCATGGGCTCG
CTAGCCAAGAACGAGTCGTTCGGCGACGTTGCTCGCAAATGGTATCGCAAAGTTGTCTGGGCTGGGGTGCTGGCTCTACTGCTGGCGCAGTACATGTTCG
CTATGGCTGGCAGTTTCTTTGTCTCAAAAGGATCGTCGAATGATTCGGCCAATGGTTCCAGTTCGCGTTACGCACTGGGAATCGTTGCACTTGCAGCTGT
TGTGCTCCTGGCTCTTGGACTCGGCATCATTGTTGTTGGTAACAATACTGACGAACTGAAGGACGTCGGAACTTACGAGCATGACCAGCGTCCGTTCAGC
AGCAAGTACAGCGCCTACTACGACGAGTACAACTTCGACAACCGCTTCTTCTTCGTACCTCGAATATTGCTGGCTGTCATGACTGGTGCCATTGTTGGTG
TTGTGAGAGATGCCACGACGCAATTGCTGTGTATCCTGGCTATCACGATGGTTTACTTGGTTTTACTGCTGATCCGTCAGCCGAACTTATTGCGGTTCCT
GTACTACCTCGGTATCATTTCAGTGTTCATGAAGGTGGTGCTTATCTGCCTCATGCTTATCGTGGCGAGAGACGACTACTTCCCGCAGAATGTGCGCGAC
AACGTGGCCTACGGCATCATCGGCGTGAACATCTTCATCTTCTTCGTGCTGTTCGTGCGTCAGGCTTTCACGATCATTCACAAGATGGTCGTTGTTTGCA
GACACAAAAAGAACGGCAAGGACAACTCCCGTCTGGATGCCACGGATATTAATCTTGAGTCCGGAAACGACATGTCCACCAACCGCCAAGCTTACGAGCA
GGCAGAGACGACGCCTGCAGGCCGCGGGGTAGACTGGTACGCGAACAAGCAGCTTCAGGAGCAGCAGCACAACCAACAAACTCAGCAGCAGTATCAATCG
CAGACCAGCGCTATGTCCGGCTACAGCACCACTCAGAGCTCCCGCAGCGGCCAGTCCGATAATGTGCCCATGCTCGAGCCTGCCCCAGAGCCCGTCCCAG
TCTTCAGTCGCTCTCGAGGCAAGATCCGGCCGCCTGTATCTCGTAACCAACAGTATTCCTTTGGAGGCTCTTCACGAGATGCAGCTGCCTTTGACATGAA
TAACGCAGCACCAGCTCCTGCTCCTGCTCCTACTCCTGAACCAGCGGAAGAAGTTCCGACGTACGATGTACTGGCTGCCTACCTCGGTACAAACAAAACC
ACTGACGAGGCTGGGTACTCCACGTCACCCAAGTCCGGAAGAGGTCAATCGTCCAGAGGCCAATCTTCCAGAGGCCAGCTTTCATCAAGGGGGCAGAATT
CATCTCGGGGACAGAATTCATCTCGGGGGCAGAACTCTACTAGAGGCCTGGCGTCGTCAAGAGGTCCGCCTTCATCGAGAGGAGGAGCTGCTGTCGCAGG
TATGTCAGGATCGGGTCTGGGATCGCGCCCTTCGACGGTGCCGCTCGATGCGTATGCTGGGAGCTTCTCAGGTACAAACTCGGGCGTAAGTACCACGTCT
TCTCGGAGGAAACGCAGTTTCGATATGGATGCTCTGCGCACAGATGTGGACATTGACGATGTGGATATCGACGACTTTGCTGCTGAGCCTGCTGCACCTT
CGACAGCTCGTCAGCCGTTTAACCCTGGTGCATCGACTGTGGGTCACCACTTCAACCCGGCTGCTTCATCGGCCAGTTCGTACGCTATGATGGAGCAGTC
GTACGTGAATTTCTCGGACTCGGTGGTATCCTCTGCCAGCAGTCAAATGGCTATGACGCAGAGTAGCGTCCAGCAGGACAACACGTTCTCAGCTGCTATG
GCTGCTCCGAAAACGAGGAACAACGGTGGCTATGGTAGCAGTCCTCAGGCGAAGATGTCCATCTTCTCGAACGATTCGGAGAACAGCTTCGACGGTGACA
GCAGCGGTTGGTTCAAGAAGCGATCCAAGACTGTGGTCAGCACGGACAGCAGTGACCACAACGACGTGGAAAGCCAAAGCTATGAACTCGGACCCCTCGG
TGTGACGAGATCCGCCTTCAATCGCGACTCGATGGACTCGTACGGATACCAGTCAGTGGCTCACTTCGCAACATCTCGCGTGGATTTCAACGCGCAGAGC
CAAATGACCGACAAGAGCAGCGATGACGGCAGATATTACCCCACTCACCGACGAGGCACAGGCTCCTCGAACCAATCGTCGAATCAATCGTTCCTGAGCG
CTCATTCCGACGACAGCTCGTCGTACTACGACGTGGACAAAGTGCGCCACGACCAGGACCACCCTAACACGTTGACGCTTTAAAGTCGTAGCAGAACCGC
ATGCTTCCGAGAGATAGGAAACCACCAGCTCTAGGAGTATCTGTATGTATAATGGAGTTGGTACTTATCAAGAAAGAAGAAACTGTTCTTTGTTTTGAGA
GAAAAAAAATCAAAATTTTGAGAATGAAAAGAAGAAGATTGTGTATCACACACCATTCATTTGTTGTGAATAGCGTGAAAATGGCGCGTGCAAGAGATAG
GGACAGCGCGGGGCGGCTGCTGCGCGTTCTGGAGGACTGCAAGCTCTTCCACGTAACTTCCAGCTTCTTCCTTATTGCTTGTTCTACCTCATTATATAAC
TGTGGTCTTCTGACATGCTGTGGTTACGTAGATGGAGGCAGCAATAACAAGTCTAGACCGCGTCAAGAATGGAATCAGATCGGAGTCTTTGATTAAACCT
TCCGACGGGAACGCAGGCGAGCTGAAACACACCGCTGATGTATTTATTAATCACTGATATTGACTGTAATGCGTTGCTACTAATTGCTAACCTTTTTGCT
GCCCAGGGTCGAGTGCTGTCGCTGTCGGACCACAAACGAATTGCGCGACTGCAAGCAGCTTTGGCTACAGTCGCCAATGCTTACGACAGTAAGAGTGGGG
TGAAAAAAGCTGTAGAAGGAGATTCGAAGCGGAATTTGGTGTGTACAGTGGCTGGATCGGCCATGATGCTGTCCATGAGGGATTGCACAGCGTCTCGGAC
CAATTGTTGCATTTGGGGCCCACAGGCGGAGAAACTACACGTTTTGTTGGACTGGGTGATGAGTCATGAGTGTGGATCCAGTGCGGATAAGTCGGTTGAC
TACGTGCGGCAGTTACTATTCGAGTGGATTCATCCGACGGCCGAAAAGCAGAACCAGTTGGCTGCCTGTCTAACGATTTTTGAGTTACTGCAGCGACATC
ATCGCATGCTAAAGAAGAACACCCAAACCGAGAGCTTCTGCTTGTTTGGTGATCGAGCTGGAGTGTTCATGGATGCACTACGAAGTGTTGCAGAAAGAGG
AACAGTTCAGGTTGCTGAATCGCATCGTGTCAAGCCATCGAAACTTGCCCTGATTGCTTTGGAAACGCTTGCGTTGTTGTGTGGCGATGTTGGCGTGCAG
TACATGACTTCGAGTGAAGCAACGAAGAGGGATCTGCATAATGGATTGATGCGTGAAGCGGTGGAGAGTATGCGCTTCTTTCTCGTATCGTTGCGGCAGT
GGCATTTGCACTCTAAACGTCGACAGTTTCTTGGATACGCTCTGCAACATCTGCAGACATATGTCGGAGCTTGTGACAGTCTCTTGTCCAGTGTGGTTGG
AGATAAAGGTGACACTCGTGACCTCGATGTAAATGTCCGAGTGGCGTTGGGTGTGTTGTGCTGGCAATGGGAGGCAACAGCCTCGATGTTTTGCACACGT
AGCAACGTGTCTTCTCGAATTCAAAAGCAGTCAGCTGAAATTCTCTCTCGGGTTGCAACAAAGTTTGCCTTTGATGCATTCGGCACAAAAACGAACTCCA
ATATCAATTCCGAGGAGATTTACGCCCGGCTGCGCTATGCGTGCGTACTGATGGATTCGTTTGGTGGAGTGAAAGGATGTTCCAAGGCGTTTGGTGACTT
TAACGTGAAAACCAAGGCGTCTTTCGTTTTCCTGTTTGTGAAGGGGTTATCTACGGCATCCAACGATGGCAACACCGCGTCAGTCCTCCTTGTTTTGCAA
GTGTTAAGGGCTCTTTTGGTGCCCAGCGATCCATTTCACCTCTTAAGCTCAAGAGACGAAGAACAAGAGCTCCTGTCGCAGTTACTCCATATATACAGTA
ACGCCCGGACCACTCGTGAGAATTCTGGTAGTGCTTTACACGCTCAAACAAAGGTGGAGCTGTTCGTAGCCGACATCATTATTTCTCGAGGCCTATTCAT
CACAGAGCTTGTACAGCAGGTGCGCGAAACACGCACTCTGGTAAGTTAAGTATTCCTGCTGTCTGAAAAGAACTTCGAAGTATGAAGTATGGTCTTATGA
AATGCTGTGGCTATTGGTTAGACTTCCATTTCGCTCGTTCGGACACTTCTCTATCGACTCGACAGTTCGCCAGCACAATCACCACTATATCGATACTGGC
GGTAAGGTCACACATGCTTTTTCTTTGACGGATATTACTGAAGTCATTGCGCTTTTATTGTGAACAGCAAGCTGCTGACACCGGCAGTGTTAGATCTTAT
AACCCACGACAACTACTATGTTCGCCGACAGGTCAGTGTTAGATAGCTGCATACAATGATTTGGTTTTCTAATGAAGATATCTGTCCTAACATGTTTCTC
TAGGCTGTATCATGCTTGCCATCACTGGATGCTGTGTCCTGCATGGCCCGATTGACCGCAGCTGGCATTGACGCACCCGAAAACCACATTCTCACATCAG
CACTCGAACTCCTTTTTGTGACTTCGACCAATAATTCCCTTGAAATGATGGCGTCTTGGTTCATTGATGCTGTCCAGTTTGGTAGTGTGCTTGTCCATTC
GATGCCAAGCAAGACCCCGGAATCTCCTCGGAAATGGAGTGACAACGCAATCCAATTGGCCTCAAGTCGAAGCGAAACCATTGCATTGGGCGACAAAGAG
AAACAACTCCAAGAAAAAATGCTGGCATTTTGCTTCGGCCCAGCTGGGTACGTTACAACACCACTGCAATGGCTGAATGGAAGGTTCCCGTTCTAATAGT
GTTGATCCATTTCGTTTACGTACAGTTGGAGCAAGCATATTCAAGCGACAGTTGCTAGAAGCGAGGTTCTTCGTATTCTAATTCGCAAAGTCTTTGGTTC
GCCTCGAGACCCGGCACTTTTGCGAATGCTGCGCGAGTTTGTGGCGTGTGGCTGGATAAACCATGAAGTTTTCCAAACGTTGGGGAAACAAATCTGCTCT
CACATGATGGTAAGGGTTTTCATTACCGAATTTTAGGGAAAAAATCTAAGCATCGTCTTTGTGATTACAGACTGTACCTCGATTGAGTGAAGAAGTATTG
AACGACAATTCACCTTCAGCTACTAAAACGATTGAAGGGCTGCTATTTTCTCGTTTAGCTCCGTTACTGGTGCTTCGAATGTTCCCCCGAAACGTGTTTG
GAATCAATCGAACCCAGGCATTTCCGGTACGTAAATCTGTAGCACATTATTTCCTATTCTGTTTATCTCTTACAGTTCTTATGTGGATGTGTAGTGTGGA
TGTGAGGATCTGGATCACTTGAATACATATCTAGACTGTCAGCAGCAGCTCTACTGCAGTTCTCCAAAAGCAAGCTCTGAAGTCGAAATGGGCACAACGA
GCGAGATTTTCCTTCACGTTCTAACTCTTTCAGTAGTTGATCCACTGGAATTCAAGGAGGTCAAGATGTTGGCCACAGAGTGCCTAGCGAAATTCCCTCC
AGCACTCGTGCTGCCGCTCGTGTCTCGATATCTGATTGCTTTCCTGCGCGAAGCCACCCCACACAACAAACGAGATAGTTCATCTATTGTCGAAGACGAC
AATGTTCCGGGTTCCTGTGGCTTAGTGACGGCGAAGCTGATGGTGTATTACCTCAATCGGGTCTTTTCAGAGGACGATCGTGCTTACCAAGATCGCGGTA
TCACGTCAAAAGTCCTTGTTCTGCTGGTTCAAGTGTTGGGAATTCCGTCCATTCAAAACTCGGAGGAAGCTCTCCTCACCGACCTCCAACGTGGTTGCAT
TGACTGCATTGCAATGATTCTCACCAGACTTGCAGCAAGCAATAGCTGTGAAGATAGCACGAAGGAGTCGGGACCTGCTGCATCACTGATGAATCTTTTG
ATGACCTGGATATTTGGTACCAAGAGCGAAGGAAGCAACACCAAGGAACGTGCTGAAGCCATTGGCTTAAAGGTGCAGGAACTGCTCGAAGGAATGTGGA
GTGAAGCTCGCTACGACCAGTTGCCACTGCAAGTTCGCATTTGCTGCTGCAATATTCTTCTCAAGTGAGTAATGATTCGCAGTGTGTTCCATGCCTTATC
GTCCCCACTAACTGAATGTCTGTTGTAGTGCCATCTCGCGATCGGAGATAAGCGTTCTCGCAGGTTGGAAAACACAGGGAGTCGTCACGCGGATTGCACT
AGCCACTGAAAAGTGCTCTAACCAGGACGTTGTTGCCGGTGGTCTCCAGGTACTGCGGTTTTACTTACATGCTTTTGCGATCTGGCTGATCGGTGGCTGT
TGTTGTTGCAGATTATTTTCCTGTTCTTGTGCAAAGCTAACGAGTTGATCTCGGTGGGAGATAACGACGATCTCCAACTCGTTCGAATCTGCTTTGAGGC
TACGACTGCTCATCTAGCGGCAACACGAAGTGAATCTGTTGCCATGAATGGACTTAAAGTCATCGGGGCCATCATTGGGAATATTCCGGGATTCATTGGA
ACTTTGTCACCAGCAGAACTACAAAAGCTCATCAACAGGTACGATAAACATTTCAGCTTAGCAGGCGATGTGGGCTCTAACTTGCAGTGCTCTGACAACA
ATGTTCCAGGTGTTTAATCGTAGTGCGCGATCGTCAAGTGTCCCCTGTTGTAACCGAGCTGGCGCAGTCACTCCTAGAAGCAATGACTCCGTGAAAAATA
GGAGGAAACACAGCTTCGACATTTTTGAAGACAGATTGAGAACTTGAAGTACTAACTGTTGAGAGTTTTCACTTAGCACGAGGGTGGCGGTCGAGTGGCA
GCGTAGTATAGCGCCCAGGCACGACTGAGTCCGTCGTCCATGGGACACGTAGCGAGTACTTCAAACGCCTTTTCACGGTCAAGAACACTGTAGTTGGCAA
ACAACAGTGACGTCCAGCCAGACTGGTTCGCTCTCCAGTCATGCACAATGGGAAGTCGGCTCAACACTTCATCCCATTCCTCGCGAACGAAGCGTGGCGG
CCGAGACACTTCCAGAATCGGAGAGACTGGGATCATTTGGATGCCATGGATGCACTCCTTGTTGGGGCTAAACCAGGTCGTGTAGTCACATTTGTTGTCG
AAGAAGACACCCGTGACCTTGTTCTTGGCGAAATTGGCGGGGTGGATAGCAGGGCCGTCATTGCGCAGCAAGAAATAGGTGTTGACGGCACGCACGTACA
GCTTGAGCATGAGTTTCGCTAGAGCCTGCTGCTCTGCATTCTCCGTCACTTGACCGTACATCGCAATACCATAGAGGAAGTTAACTTCTTCTGACGTCGA
CTCCTCGTCCTTCCCATCGGCCATCGGGGTCACGCCGTGTGAGTACGAGTGGCCCAACCACCAGTTGTAGTATCGGAAGCGTGGGAAGTACGGGTCGCTG
CCGATAGGAGACGACGTTGCCACATCCCGGATGAGAGTATCCACGATTGTTCGAAGCTTAACGGCATCTGCAGAATGGCGCCAATTCGGATCCAAGTACA
GCGCAATCGCAGCCGCCATTACGATGTAGCCGTAGTGATAGTGGTGGTCGTTGTACACGCCATTACCAAAGTCCACATTCATGTCATTCCGAGCCAACGC
CTCGCTTGAGATGATTCCTTTGTACACTGTATCGTAGACAAGAGGGAACGCCGACTGGTTGTCCGCAAATTGCGACAGCAACTGCTGCAACTTGTTGATG
CCGTGCTGCGCCACATCCCGCATCTCCGGGTTGGTGGTGTCTGCAAGTTGCTGAGCCACAAGACACATCGTACCGAACTTCTGCAGCGCCTTGCCCTTGA
AGTAGTAGCTTCCTTCATGCGGAAGGGACCAGTCCCCATGGATTTCATCGGCAACAACTCGACACAAGCTGAGCCTGTCAACCACATCTCTCGTGAGGGT
CCCAGCACGAGGTGGGTAAAATGCTGTACACATTTCCACCCCCTGGCTTTCTGCTTGAGGCACATGACAAAGCCATGTTGGATTGGAATTGGGCGGAGTT
GTCAACATGTACGCAAACAGCGGTCCATGCGTGTGCGAGTGCAGCATGAGCTCGTGCTTGGCTTCGACAGTGGAGGGATCCAGCATTCCTTGCAGATGGG
TCAGTGCGAAATGCAGGAAACGAGCTCCGGGGTTACTTCCAGGTGCACTTACAAGTTGCCAATTGAAAACAAACGACTCCGAATTCAGTGTCTGGACAGA
AGCCCCTCTTGGGTAGACGCCAGCACTTGCGTGGTAAAGTTGCAGGATCTTGTGCTCGTCCTGTGGCACCGAAGATTGCACTGCACTGGACGAAACAAAA
GCTGCTTGAACAACACCCGTGAACTTTGAAGTGGTCGTGAGCTTGTTGTCCTTGAACACCAACGAGGTATTGCCACCAGCATTGGAGAAGAAGTAGAGCA
CCCACTGTTGTCCGTTGTTCAAGGAGATCACGAAGCTGATGCCATTCACCTGGTGACCGTCTATCGCAGGAGCTCCATTGATAGCCACGATGCAATGCTC
CGTACCGAGTTGCACCTGCATTTCCTGGTACTCCACCGTCGTGAATGCTGAGCCCAAAGCCAAGTACATCCTCATCCCTGTCATGGACAAATGCACTCCC
ATATCATCCCAAGCTTGGATGCTAAGAGGTGGAGGGCCAGAGTGACCTGCAAGCTCCACAGACGAAAAAATCCAGTTCTTGATCGTCGGTGGGTAAAAGT
AGAATCGCGGGGCTCCGTTGTCATTGATGGGGCCGTCCGACCGGTACTGCATCAAGTAGCTAACCGAGAGGCCGCTGCCAATGGATCCGGGTTGACTCGG
CACCACCTTGTACGTATAAGGGCCGGCAAACACAGCGTCACTGTCTTTTTGTCCGTCCCACGCCAGCAAGTTGCCCCACCATTCGTTGGTCGGAATAGGC
CTCTGCTGCGCATCTGGAGACAGGAAGTGGGGCGAAATGAGCCTCTTTAAGTCGCTCGTTGACCGGAAAACCGGCGGTGGGGGAGCAACAGATGCCGGTG
GCGCATTGGGCGGTGCAGGTGGGAACAATGAATACGACATGTCGAAGGAGATACCCCGTTGTTACCGGAGACTCGAGGGGTACGTGGCGGATTCGAAAAT
GAAGCAAAAGATTTTCTGAGTTTGAGTAGCGTCCGGATAACAAAATGACTGGATTTTAGTATGCCAATCCGGATAATGGGCGTTTGTCTCATTTTGGTGG
GTGAATTATGAAGCTTCTCGCTCACAATTGCTTCTACACAAAGCTAATAGCCGAGGCAAAGCTAACCTTATAGTGAAATTATTCCAAATGAAGGAGGCGT
AGGATGAAAATAATACACTTTGTGCTATATTTGTAAGTTGAAGCCCACAAAGCAATCCCTCTGGCTGCATCGGCCTCATCGACGCGCAAGTCTCGGGAGT
TATTTGCTACATTACATCTATGGCTAATTGGTCGTTGTTGTCACGGTTTATTTCCACGTGGAATTATCTTCGAGTTGAACAACGTGGTCACTACTCTGTG
GAGCGTCTGAAATCTCTTCAAAAGTACTGCGACACAGTCGATCTCATGGAATTATTGGCTTTGGTCCTGCTTACACCTCTCCCTTGCTTGCTCGCGGTTA
TCTTGGCAGATGTCGCTCCCCTGAATCCGCCTGAAGCCGGTACAAACTCTAATACAATTTTCTGGCTTCGATCTTGCATGGTAATAGGGATATACACACT
GTCCTTTGTCGTACAATTCCAAGAAATGCTACCCGTGCTACCCATGTCTCGAGCGCGAAGTATTGGAATCACTGTATTTGTCAGCAGCGGTGTTATTTTA
TTCGCCTACTCCATGTCTCTCGCCATCGGCTTCCCAGTTCCCTTTTTGATGGTGATCGGTGCTCCACCTTGGATGATACTTATTATGGGGTCGTTTGGAG
CAAGTTGGTGGCATCATGTTCGAGGCAACAGTGCAATTCAGACACAAATTGTTGATGGGCTCAAAGTGTTTATGGTTCAAATGTCGATGATCGGAGTCTA
TCCGTTCTACATCTACGTTTTTACAAGCTTATCATCCGTTGAGCAGGCCTGCTTCTCACTTGTATTGTTTATTATCAAGCTGGTAATCAAGAATGGAATT
AGTCACTACGTTCGGTCAAACACCGACATGCAGCCAGAAATTGTCGTCTTCAACGTCGACGTCTTCAATGCCCTGTTCGTATCCTTTTCCATGCAGAATT
CGACGTCAAAGCTCACGGTCGTTGTAATTATGGCCGTGGATTTTATACGCATGGCAAGTTCACTCCGTGAGGTCACGCAGTTGGTTCGTGAGCTCAGGAA
GATCGAGAACCAAATTATTGTGCTGAAACTTGCTCGGGGCGACTCGCAATCATCACTCATTCAAAGAACCCCCCTGAACCGTGCATGCAGCATTGTAACT
CGACGTTCGTTGGCCTCCAATAATTATGGTCTGCATCGACACTCGACCAAGAAGTCTCCACCAGTTCAGGTCAAGCCACTAGATTTTCTTTATCGAGTGA
AAAAGATTCACCCGAACCAGAATCTCGATTTTGGGCCCAAATTACCTGGGATTCGAGCGCCCGAGCCTCCCAATGATCGTGGATGCAGCTATCGTTTAAA
ATCGCCCTCAACAGCAGATCCCCAAACTAATTTGGTTTATATGGAGAGGTTATACGCGAGAAAGGTGTTGAATCTACTGCATCTCACGGAATTCACTATC
CTTGTCGAGTACATTGAGGTGATTGTACCTGTCGTCTACTGTACGTATCCTGGCGTTCCTTTTGAGAACATACAAGCTTCTCTAATGTGACCGTATATTC
CTGTGGCAGCTATCTACGTCATAGCCATGTCATTTTTGCCGAATCGCGTGTACTACGCGCAGCTTGCAGACATGAACGCCGAGAAACTCCGAAGTACACT
TTCTAACGTGCTTTTGTACAGCCTTCTGGAGTTTATCTCTCTTATCGTGCTTACGGTTTTTCTGCGGAAAACGATGGGGTTTTCACCTGTCCACCAATTG
GCATTCGTCCTTCGCACTCAATGGAAAATGGTGCAGTCAAAGCTGGTGCTGTGGGTGCTTTATGTGGTGCAGTCATCACTCGTACATTTTGGTAGGAGCA
TTGAGCTTTTGAATATGCGCATCACCGAGTAATATGTACTAACAAGTAGTGCGGTTGTTGTAACTTGCAGGCGCAGACTATAGCTTTCAATTCGCGTGGT
TGAAAAATGACTCCGTGTGAAGCTCACACTGTAAGCTCCGGCGTGCTCTTGTAAAGGGTTTATGCGTCCTTATAGAGAGAGTATTACTCTGTGGCCGGAG
TTGGCAGGCAAATCCGCCGCTGTCGATGGTAGTGCTGCATCACAACGAGCTGGATCGCACCTTGTGGGGTCCGGCGTCGACTGCTGGTCGTTCACGAGCT
ATTGACGTCGCTATCTACGTCCAGCTGGTAGTGTGCTATGCTCTGAGTTGGCTGGCATCTCTGTAATAACGACAATAATCCACGTGTGTGCAGGCGGTCA
TTGCGTTGCTGGCCATTGTCTGCATTCTAGACTACGAGAAGCCGGAAGCTGTACGATTAGCAGCTGCAGGGGGGACGTTGTTGGTGTATTTCCGTAGTAC
TGCGCTGGTAAGAGCACGTGGCTGAATTTCGACCTACAGAGTGAATGACAAGGCGCAGTTTATCCGCTTGATGCTGTTTGTAGCCTCCCTCGTGCTGTAT
GGCGATGTGATCGCTCCCATCGTACGTCTTGCCCGAGGCAGCGATGTTCTGGCTCTTCCTACGACCAAGCTAGTGCTGCACTGCATCTGGGTCTGGAACA
CGGTGAGCCACGACTGTAGATATTCCTCATTATATTTGCTGAAAGTTGCTAACTCGAGCTGTTTTGGTAGCTCCGCATCATGTACGCA