Description :
From Genome Similarity Track
Location :
Scaffold_89:57432- 59526
Transcript NameFunction/comments
Phypl_g2847hypothetical protein

Sequence
2094 bases(100 bases per row)
AGTCCCCATGCTACTCCAACGTTCTGCGTGCGTAAGTCGGTGGGATGGCGGATCGTCCATGACTACCGGTACCTCAACAGCAACACGATCCGACAGAGTG
TACCGATGACACGTAAGGAGGATGTCTTTGACAGCATGGCTGGCGCCTACTACTTCTCGTGCATGGATCTGATGTCAGCATACTATCAAGTACGCATGAA
GATGGACCACGTCAAGTATACCGCGTTCCAAGCGCCAAGTGGGCTCTACGAGTACCTGGTGCTACCGATGGGAGTCAGCAACGCCCCAGCAACGATGCAC
CGACTgacctcgtcgctgttcAAGGGTCTATCACACACGCGTTCGTTCTATAACGATATCTACGTGTTCACGAAGTCGAAGGACATCAAGGAACACCTGC
GAGCTTTACGCGATGTGTTAGAGAtactgaagaagaacaagctcTACGTGAAATTGGCCAAGTGTGTTTTCTGCGCTGAGGAGATTCCATGCCTTGGAGA
TTTCATCGGTCGGAACGGCGTTCGCATCGACCCGGACAAGGTGCAGACGATTCGAGATTGGCCAATTCCACGAACTCAAGACCAGCTTCACAGCTTTCTC
GGTTTAACTGGATATGTCCAACGGTTTTGTGAACATTACGCGGAGCTCACGGCACCACTTTTCAcactgctgaagaagaagaaccaaCACAACTCGAAGA
TCACGCTGGATACGGGACAGCTCAAGAACTTCAAGAAGCTTAAGCGACGGTTGGCGAACACACCAGTGTTACAGCTACCAGACTTCACCCAGCAGATGCA
CCTGCGGACGGATGCAAGTCAGTttgctgtcggtggcgtTCTCTTTCAAGTGATCAACGGAGTCGAGCGACCTATCGCGTTCACTAGTCGCAAGATGAAG
TCAGCAGAGCTGAAGTACCCtactcagcagcaagagctaCTCGCTGTAGTCAATGCGTTAGCCGCTTTCCGCATCTACTGCTTGGACCGACCAGTCATGA
TTGAGACAGATCACAAGTCTCTCGAAGGTATCTTTCAATAAAAGATGGCCAATCGACGGCTGGCGCGCTGATACGACATTCTCGCTGAGTACCAACTAGT
TTTCGCGTATCTTCCTGGAGTCAAGAACGGCATCGCAGATGCTCTCAGCCGACGACCTAATCTCAAGCCTGAGACGAAGGAGTTTCATGACTTACTCGTT
CCCAGTTTCAACGAGACAAGCTATCAGCTTCGTGTCATTGAGATCAAACCCATGCGTGATCTGGTCAAGTCCATTACTTCTGGTTACGCGAAGGACAAAG
TGATTCAGGAAATTCGACACGCGATCAAGAAGCGCGGAGAACCCTCGAGGAAGCGGGGGGTATCTGCGAAGCAGTACAAACCGTACTTCGAGAAAAATGA
TCTTCTTTGGTACCAAGGGTCAACGGACGAGAAGCCCCGCATCGTGGTTCCAAACAACATCAAGCTCAAGCATCGTATCATTGCCGAAGTTCACGACTCA
AACTACAGTGGACACCCTGGTACCGACAGGACATACCTGAAGCTTCGCGCTGACTGGTATTGGTCACGAATGGCGCGCACGATCCGGAAGTACATCTCAG
ACTGTGAAGACTGTCGACGGAACAAACCACGCCTATCGAAGACACCAGGATTGATGGAACCACTACAGATTCCAGACGAGCGATGGAGTTCTATTTCACT
GGATTTCATTACGGACCTGCCGGATACCAAGAGTGGACACAACTCAATCTGGGTTGTGGTCGATCGACTGACCAAGCGTTCTCATTTCATCGcaacgacg
aagacagcCACGGCTCCAGAAGTCGCGACACTATTCATCGATAACATTTGGAGATTTCACGGCATGCCCCACGACATCGTGTCAGACCGCGACACCAAGT
TCATCTCTGGGTTCTGGGGTAAAGTGTTTGACTTGGTTGGGACCAAGCTGAAAATGACTGTCGCGTACCGTGCTCAAGGCGACGGACAGACCGAACGGAC
CAATCGAACGCTAGATGAGTATCTGCGCTGTTTCGTGTCGCCACGTCAAGATGACTGGGATTTACATCTCGCCAACGCGGAGTTCGCAATCAAC