Description :
From Genome Similarity Track
Location :
Scaffold_151:5743- 9689
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_151-snap-gene-0.14Transient receptor potential cation channel, subfamily V, member 6
Pytul_var.sporangiiferummaker-pug3_contig_151-snap-gene-0.20Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_151-snap-gene-0.21Anaphase-promoting complex subunit

Sequence
3946 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACGTCGTATACTTCCGAACGGCACCCGGGAGCTCGCTGATCAAGCCGAACGTGCTATGTGT
GCTGCTGCTGGGCGACCACGTCGCACCTTCGGAGATGCTCAAGGCACGTGAGGCTCACGAACGCGGCAAGTTGTTACACTTGCTCATCGAGAACCTACCG
GATGCCGCGGTGCTCGCAATGGATTCGTTCCGGACACCGCTGTTTCGGTGCACNNNNNNNNNNAAGGTGCGCGAGTTCAACCAGCGCTGGGTCGTGCCCA
CGAAGCTCCAGACGCTGCGCGAGAGGCATCACGCACTGCTCTTGGCCATGAAGAAAGGGACACGCGGTGCCGTGCTGGACGCCCACTCCAAGCGACTTCG
ACAGCAGCGACGCCGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGGCGTGGGATCAAGAAAGCGTACAAGCTGCTGC
GCAAGCTGAGACTCGCGTTGAGCGTGCAAAACGTGTTTGATGCGTCTACGACGAGCGAGCACAAGGCGTTGGGCCACTCCCGCGACCACAGCATCATCTG
CGAACCCAAGGGGATTCTGTACGAGTACATTTACGACCACGCCGAGTTTCGCGGTGGGTTGAGCCCCACGCTCACATTGGTCGTCCAGGTACGGCGTCCA
TCTGAGTCTCTCAGTTTTTGCTGGGATACAAGCACGAACAGTGTTGTCTGTCTGACGGTCTTTGTGGGGTGTTTGTGCAATAACAAAGACAGAAAACAAG
CAACTGATGGGGCATCCGTGGGTCAAGCAGCTCATGGACCACAAGTATGGAGCTGACTGCGTGTATCGAGCAGCCGCTATGTCAAAGAAATAGCACTGAC
AGATGGTGTGCTTGTGTGTATTTGTTCTTGCCACCAGGTGGAATTCGTTTGCGCGACAGACGTTTCGTTCAGAGTTCCATCTCTACTTTGTGTACTTCGT
CTCAGTGTTTATCGCCACGTGAGTCGATCGAAAAAGCACATGCGCAATAAGCACATACTAAGATGTATTGTTTCTGTGTGTGTGAATGGACAGGTACCTG
CACGTTGGTGATCCGTCCGTGGGGATGCCGATCGGCGGCTACCGCAGTAACATCTTCACGAACCACGTGAGCGCGGCCGAGTACGTGCGCGACACCGCGC
GACTCATGTATACGCTCATCAATATCTTTTACACATACGACGAGGTACGTTGCTCGTGTTCATGGCTTTGGTTTTGCTTTATTCACGTTTGTGATCCGAC
ATTTTCCGCAGATCCGCTTGTGGCGAGAGCTTGGAAGTCTGCGCGCGTACTTCAGCGACGGGTGGAACTGGTTCGATCTCGTGCATATCCTGTGCGTCTG
GCTGCTCCTGGTCACGGAAATCATTGACATGTTGACGCTAGAAGGTAGCGTGCTCTACTAGCGTTGTGTTCTTGTGCCATGTGTGCTGACGGCTGCTGCA
ATAGCCGACAACATCCCGGATTTCGAACTCGTCGTGTTCCAGGAATCGCTCTACAGCACGACCATGTGGCGCAAGTACAACCTGCGCATCACGTTAATGA
GCATCGTCGGGCCGCAGGTGTTTATCCGGTGGATCCGCTTCGCTCGAGGCAACCTGACGCTCGGACCCTTTGTGCGCATGATCTTCAAGGTTGGTCATGT
GTGTGAGTGTACGTTATAGCATGCGTCTGTTATCCTTACGCTCATGACGTTTGTTGTGTGTCTCTGTAGATGTTTAAGGACATTATGCTCTTCCTTTTGG
TATTTGGGGTGTTTCTTTGTGGCTTTGGCTTTGCGTTTTTCATTCTTCAGGTACGACTTCTTGGGTTCACATATTCTCCCATATGCACACCTCCACTAAC
ATCATAAATGCCAAATTATTACAGCTGGAAGGGTGCAAGACGTATTTCACGGCGCTCTCGTCGGTGTTTCAGATCAGTTTGGGCGCCTGGGACTGGGAAG
TGATCTACGAAGGCGGCCCCATTGCCATCCTGTTTTTCATCGCGTACGCCGTCATCGGCACGATCATGCTGCTCAATCTACTCATCGCGGTACGAACCGG
GTATACGCGAGGTGCTGGTGCGTGTTTTCCTGAAATGAAACCTCACTTTCTACGGCTTGCTTGCTTTCTTGTGTGCTAGATGCTCGGCAACACATACGAC
AATATTTGGGAAGATCGCTTGCTCTTCTTTGAGCTCGAGCGGGTATGAAAACAGAGAATGGGCTTGCTCGCAATATGCAACTCTAAACTTTGCTGTTTTT
CTCTAGGCCAAGGCGACGATCTCGATCCAGACAGCGCTCAATGACAACAAGTACGACGAGCGCTACTGGTGCCAACAGCTCTATGTACTCGAAGGCGACA
CGCCCATCGAGGGCATCCAATTTCAAAAATTCTGACACAGACGAAGACTCTGTTCACGCTTCATTCTTACCACTTGCGTACGACGGGAACACGCGGTCGA
CAATGTCAAGAAAGCCGACGAGGATCATGCGCTTGCCCTCGAGCACGGGCGCGCCGGCGTGACGCACTTTTNNNNNNNNNNNNNNNNNNNNNNGCTGTGC
ACGACCGCATCGCCCTGCGTGATGTGGATTGTCTTCTTGGTCGCTTCAAAGAATGTGCCACCTCCGGTGAACTCTGCGGCATCGTTGAGCAGCACGTTGA
AGCTGAGCACAGAGCCGTCGCAGTGGATGCCTAGCTCTGCGCGCTCACCGGGTTTGGCTTCGTACTTCACGTAAAACAACTCGCGGAACGTGATCTGCTT
GGTCTCGCGCGGGATCGCGTAGCAGTCGTAGAGCTGGGAGAATAGCCTGGAGACCAGCGTGCCGCGCACCCAGGACTCGATGGGCACGACACGGTAGCAC
GGCATGTCAGTCGTTGGGTACGCTGCGTGGCGCTGCGTGCACCAGCCGTGTTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGCGACACTCGC
CCTGAGACCAAATCTTGGAAAACTTATGCGATTGCAGCATGGATGCGGGGGCTTCGAGACTCGCAAGGNNNNNNNNNNCGTGCCTTCGCCAGTGCATCGC
GTTCTGCTTGAAGTGCGGGTAACGATGCGCTTTCGAGGATCGGCTCGGACGGAGTCAGCGGCTGCACATAGCGCAAGTTAGTAAATAGTCATAAACAATA
CACACTTTGTGCAACAGCATTCCGTGCAGTACCTGTAGCAATGCCACGACAGAGTCATGGCCGTACAATGCAGCGAGGCTCAATGGTGTATTCCCGTCCC
AGTCCCTTTGGCTCAAGGCGAACTCGAACGGCGGCGCGAGGAGCATCTTGACGATGCCAAGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGGATCTGATTCTTGCTCATGGGTAGCACGACGTCCTGCGTGACCACGCGCGCGCAAATCTGCTTCAG
CATGGCAGTGCGGCTCTCACTCTTATCGTGCTCTGTCCATACGAGGAGGTCGTTGGCGACGCGCGCTACGAGCTCGTTCATTTGAGCCTCGATCGCGTAG
TGGAGTGCACAAAACCCGTGACTGTCACACGCATTGTCGAACACTTGGCGCAGCAGATCGAAGCGATGGCGGTGCTGCTGGAAACGCACNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGAGCTCCTCGTCATAGATCGACGTCGCGAACAGCAGCGCGGGCTTCCCCATCACCAGA
AGCACCACTTCGGCATCGATGCCGTCGTATGCACTGTCGCCTGTATCGCCTGCAGCAGCAGTATGGTCCTCTCCATTGAGCACGTCAAACTGCGCGACGA
TGTCGCCCACAGCGCGCGTCGCTTGCACTGGAGCCTGCCACTTAAG