Description :
From Genome Similarity Track
Location :
Scaffold_1:5742642- 5753995
Transcript NameFunction/comments
Physo_553615replication factor C subunit 4
Physo_476975WD domain-containing protein, putative
Physo_295483Hypothetical protein
Physo_310799Rab1 family GTPase (PiYpt1)
Physo_355158autophagyrelated protein putative
Physo_475537Hypothetical protein

Sequence
11353 bases(100 bases per row)
CGATCATGTTCAGCACCGCGTCGACCTCCAAGACCAACCTGCCAGCGCCCGTGCTGCCCTGGGTGGAGAAGTAGTACGTGTACCATGTTAACCGACATCT
ATAGCTGTATTATAGCAACTCAAACGACTCATACCTTTCGCTTGCTGCGCTCCAGCCGTCCGAAGAACGTGGACGAGATCTCGCACCAGGAGCACGTAGT
GGCCACGCTCAAGACGTCCATCGCCAATGGACAGCTGCCACACTTGCTCTTCTACGGGCCCCCAGGAACAGGCAAGACGTCCACCATTGTGGCGGTGGGG
CGCCAGCTCTTCGGCCCGGACTTCCGCAAGAACGGCCGATTCCTGGAGCTGAACGCGTCGGACGACCGAGGCATCAAGGTGGTGCGCGAGAAGGTTAAGA
GCTTCGCCCAGGGCGCCATTAGCAGCGCCAGCGGACTCCCTCCCTTCAAGATCATCGTGCTGGATGAGGCTGACTCCATGACGGGCGACGCGCAGTCGGC
GCTGCGTCGCATGATGGAGAACTACTCCAAGGTGACGCGCTTCTGCCTCATCTGTAACTACGTGAGTCGCATCATCGAGCCTGTGGCCTCCCGATGTGCC
AAGTTCCGTTTTGCCCCACTTGAGAGGGGCTCCATGGCGTCTCGCGTGCGCTTCATCGCTTCCGAAGAGCACGTTAATGTGCCGGACCCGGTGTTGGAAT
CGCTGCTCGAGTGCTCGAACGGTGACTTGCGTAAGGCCATCAACTACCTGCAAAGTGCCAAGCAGCTCTGTGGAGATGACGAACTGTCCCAGGATGATGT
CATTGCCGTGGCTGGTCTTGCTCCGCCCGAGCTTCTGAAGCAATTCTGGGTCTCCGTGGCGTCGAACAGCTTCGAGAAGATGAAGACGGACATTGAGAGC
ATTCTGCTGGCTGGATACCCAGTGCTCACGATTTTGCGCCAGCTGAACGACGATGTTCTGGCGCTGGACAAGCTGAACGACGTGCAGAAGGCGAAGATCA
GTCTGCGCATTGCCGAGGCCGACAAAAGGCTTGTGGACGGCGCCAGTGAACACTTCCAGTTGCTAGACGTTGCATCGTACGCCATGCGCGTTTACCACTC
GGCGTAATAAATCTATGAGCTTGGTATGACAACAGTGACGCAGGCGTAAACAGTGTTAACGAAATGAACACAGCAAGCTCCTAGTATTTTAGCAAACGAA
AGCAACTGCCGTCAGCAAGGAGAACGTTGTCCCCAAGTGGCGGTAGTCCACTGCTAATTGATGATGAGTATCTAGTGGCTCGCGATTGTAGCTGCTCCTT
GGTCAGTGACCGAAGACATCTGCGTCCATTCGTGGTTGCTTTGTTGCTTCCAGAAGGTGACCTCGTCGTCGCCGGCGGCAACACTGAGCACTGAGCCCGT
CAGCGACCAGCTTATCCGGTACACAGGCGCGCGGAATGTGTGCACCACGTGTGCTTCCCACTCGCCATCAGCCTCGTCTTGAGTCCAAACACGCACCGTG
TGATCATCTGAAGCCGAGGCGATAACATTTGCGGGAATACCCACGTTCGGCGCCCAAGCCACGTCACGAACCCAGTCATTATGCCCATACAAGGGGGTGT
TCACGACTTCCCAGTAGCTATTGCCAGCATTCGCGCCTTCCTGTGGGGCACTCACAAACTGCCAGATAGTCACTGCGTGATTGCACGACCCAGTGACCAC
GCGTTGAATCGGCCCTTGCGCCCCCTGCGATCCTAGTGAGTTGTACGGAGCCCAGCTCACCGAAGTGCAGCCCATGCCCTCGTCGGAGTTGCGGAAGCTG
GACGAAACCACCCACCCTTCTCGCATGCGCGTGAGGAACGACACCTGACCGTCAGCCGACGCACTCGCCAGACACAATCCGTACTCGTACGGGGCCCAGG
CCACACTCAACACGGCCAGCGAGTGGAACTCGTGCACGTGCTTGAGGCGCCATTCCGTCACGTTGCCGACTCCCCCGGCACCCTGCTGCACCAGCTCCTC
CCGGTAGATGTACACCTTGCCGTCCTGCGCAGCCAGGGCCACCACGGCGCCGAACTTTGGGTGAGCCCATGCCACGCGGTGGATGGGGGCCGCCGAATCG
TCGGCCAGGGGCACCACGTGCTGTAGCACGTGAAGCTGCTGCTCTTGTTGAGACTCCTGCACATCCTTCGGCGCCGAGTGCTCGTCGCCGTCTCCGCCCG
CCACCATGGCCTTCGATACGTCATACACGCGGAACGTCCTGTCGGACGAGCACGTGACCAGGCGCTTGCCGTAGTAGTCCAGCTGAATGTCGTAGATCAT
GTCATTGTGCTCCGTGTCGATGCTCGCCACGGGCGCTTGGCGTGGCTGTTGCTGCTGCTGAGGGTGAGGCTGGCCGTACGGCGCAGCAAACTGCCCGCCC
ACCGCCGAGCCGTGCGCGAACTCCATCTCGATTGCTGATGTGGCAATTGCGCCGGATACCGGGCGCAATTGGGACTATTTCACATATGTTGCTACTTTTG
TATGTCTAAAATTGATCAGCACCATGATGATAATTTCGGTAAAGGCAACTTTTGTGCGCGATGTTTGCTGTTAACGGGCCGTCTGGGCCGACGACGCGTC
ACGAGCGGCGAGTGAAGACCGACCGGCAACGAGAAGACGAGGAGGAGACCCGCAGGCGCTGGGCGGAGAAAAAGCGCGAGCAATTTTTCCGGGAGAAGCA
GGCGCAAACTGACGAGACTGGCAAACCTGGTCAGTGATGAATGAGCTGGGGGTTTGTAGCGATAAGTGCAACTTGCGCGCTAACAAGAGCATTTCTTCTC
ATTGTTCAGCAAAAGGGAAGAGCAAGGAAGCAGAACATTCCGTTGAGTCTGACATATTCAAGGTGGATATATGCGACGAAATGCTGGAGCGTTCACGAGA
CTTGGATTGACTTTTTGCGTTTTTGGCATTCGTTTTCAGGGATGCCGGATTGTGTTTAATGGGCGCACAGGCAAAGTGTCCTCGTACGTCTACAGTATTT
AGCAGTATGCTACGTGTTGCAGATATGCTCTAACACGGGTCGGTGCAGGTATTACTTGGCAAAATTGGTGCAGGAGCATGGTGGCAGCGTCGCGTACGTC
TTCTGCTGACTCAATTTGAAGTTGCAGCAAACAGATTTGCTTATTATTGTTTGTTCTATTCATCAGCTCTGCGCTCACCGCCACGCGTGTTACGCACATG
GTCGGCTCCAACTTAAATGGATCCAAGGCCGACAAGGTAGTCAAGGTGAGAGCCCAAACCTACGTTTCTTTCATCAAAACTTCGCTGCGTTCCATTGACT
AACAGACTACATGTATCTACGTATGGACAGAGCTCCGGCAAAGTCAAGTTTGTTAGTCCAGGTAAGATACATGTACATCAAGGGTCCACGGTGAGCTATC
TAAACTTTAACTCACAACTTCGTCATTGTTTGTCGTGACCGCAGAATGGATCTTAAAGTCCGTCAAGCAAAAGAAGCGCCAACCGGAGCATGAATACCTG
GTCTACAAAGATGCTCGTGCTGCCAGTTCGCTTCAGACTGCATTTTCACGAACAGCACCACCAAAACAGTAAGGGGCTCACTGTAAGGCCAAACGCGTCA
CGAGCAAGGCTTCCATTACAATCCGCACACAAGTGCAACGAGAACGCAACGCAAAGCTTAAAGCTCAAACACCCTTGTAAAAGAGAAAGAATATACCATG
TATAGGGTCACAACTAATCAAAGTAGCATTCGTTGTCGTTCCTTTCAGCCAAAACCGAGAACGCGACAGCATTAAAAGCGAAGGCGGAGTTGACCTGCCA
TACGCTCCTTTCCTAGTACCATCGCATCCTCGAACAGCCTTTCACCCGCGCCGCACACCACCAGCCTTACTGTATTTAACCTGTCCTGATCTTCTGGGTG
CCGCGAGCACAACAGAGCCCATTTCTCGCGCCTCGCCGCAAGAGACTCCAAAGCTAAACTGCAGACAAATCAACTGGCGCGCGGCGCGAGGCGAACAGGA
CTAAACGACACCGCTTAGCAGCACTTCGATCCGCCGTTGGACGGAACCTGCTGGCCGGGCGTCAGCTTGACGCCGGCCTTGGGAGCCACGGGGGCGTTGG
CCATGCGCTTCTTGATCTGGGCGGCCATCATCATGAAGGCCTTTTCGACGTTGGCGGCGTTCTTCGCACTGGTCTCCAGGAACTCAATGCCCAGGCTCTC
GGCGAACTCCTTGGCGGCGTCCGTGCTCACGACACGCTTAGCCGTCAGATCGCTCTTGTTACCGACCAGCAGCTTGTTCACGTTCTCGCAGGCGTACCTG
CAAATCGAAGCGGTGCAACAGTTAGCACCATTCCGCGGGATTTTTCTACCCAACAACTCTGAGATCGAACGCACCTATCGATCTCGTGCAGCCACTGCTT
GACGTTGTTGAACGACTCCTGGTCCGTGACGTCGTACACCACGATAATACCGTGGGCACCGCGGTAGTAGCTGCTAGTGATGGTGCGGAAACGCTCCTGG
CCGGCCGTGTCCCACTAGAATACCAATAATCAGAAGCGTACACCCACCAGTTAGAACCATAAGTGCGCTTAACCGGCGAATGTACCGGGGTGAACGTACA
ATCTGGAGCTTGATGGTCTTGCCGTCCAGCTCGATCGTGCGAATTTTCTGGGCGGGACAACGGGCACAATATTGTCAGCAACTGGATCGGAAACCTTAGC
CATCCTGGACTCTAAAGCGTCCGCTCGAGAGGGCAGACAAGGCCTATTTTCGCCACTCACAAAGTCCACGCCAATGGTCGAGATGTAGCTCTCCGTGTAC
GTGTCGTCGGCGAAACGCAGCAGCAGACACGACTTGCCGACGCCAGAGTCACCAATCAGCAGCAGCTTGAACAGGTAGTCACTGCGCACAAGAGACAAGG
GGGGGTCAGTACGGTGCTGGTCCGTGGCCGCTATAAATCAGTCTCGGCGGCACGCACTATTCGGGGTTCATGGTGGACGATTCTGGGGAGAAAGCGGCGG
GTGAAGGCGCTTAAATCTGCAGCACAGCGCAGCGAAGATTCGGTCAGTCGGCTAGGCTCCTACTCCCAAATGTGGCGCCGACCGCGCTCTAGCGCTCGTC
CCTCGCTCGGTTCGGGTCCAAAGAACACGGAAGGGAAGCAAAAGATCGAGGATCCGCCCGCCCGCCCACTTCGACCAGACGGCGCGGGGGAGAGCGGGAG
GACGCAGGGGGAGAGCGCGGCGCTGGGGGTAGAGGACGCATGCACCCACGTACACAGAGAGAGCAGGGAGGAGGCGACTCGCGCGTTCCGAGCGTTCTTG
GGTTGTGTGCCGCGAGTGGGTGCGGGGTGCGCGTCGAGTCTGCGTTTGGGTTTCCCGAAGAAAGCGGAGAAAGAACGGGGGCCGCGGTCCCGGGGCCGTT
TTCCCCGAGGTTTTACCCGCGGGCAATCGAGGTTTTTCACGTATTTCAGCCAATCGCGGGGTTTTCGCGCATTTATGTCCAATCACAGACCTTTCATTTA
AGCCAATCACAACCCCCAGCGTGGCGCCGCGGAACTCATCTTGGCGGGATGCCGCCTGAATGGACTTGGCTTGATTTCGCCAAATGGCGCCGCCGCACGT
TGAAGGCGGCGACGGAGCTCCGAGCTCTCGTACACGATGGCCATGTCATGGGTCACCACCTCATCAGACCCAGCGCCGCCAATGAAGCCGCGCCCGGCGA
TGCTGTCGACTTCCGACGCATTGGTTGCGCCGCGATTGCCATCACCTAAATATACACCTGCGGCCTGAAAACTGGGCTGATGCAACTCAAAAAAATCGAC
TGGGCGAGATGGTAACCGTGGAGAAGCAAGAAGGCTGCCAGCTGTCTCTCAACGCTCCGCCGCGGCGAGCCGACTGCAAGTGCTGCTCGATGAGCAGCAG
CGCTTGGGCGTGGAATCTGTGGCGAGGTCGAATAGATCCCGCCATAGCTCTCGACCGCGGCGGCGCTTGGACGTCGCTATAATAGCCGAGCGCTTCTGCG
CTTACCTGCTTCGCACAGCTAACATTGCCGAAGAGCATTGCACCTGGAGAAGCGATCTTGATCCTCAACGCGGCGTCATCGCTGGAATGGCCCAGATGCA
CTGGACCAACCCTATCCATGTTGCAGTGCAACCAGAAGCAAGAAGATGAACGTGCCTTTTCCACTCTGGCGGTGGCACCATTGCACTGCGGAGTGCTCGA
CTGCAGCCTGCTTGCCGCGGACGCCGTCGCCTTTGAAGGACGCTTGCATCGCATAGTTTGCCCGCTCTCGATCGCATATTCGCCATACTGATTTCCGAGA
TTCATTTCGGTTCAACCAGAGTGATGATCACGTCCTCGGATTTTTAGCAGCGATTTAGCAGTAATTATCTACCATTCTCGAAGACCTTATCCTTGCAAAT
GCTAGTACACGCGCGAATCCGAGCGGAGCTATACGCCTTATTAGGGACCCTATTAGGCCTCCGATTAGGATTCCTATCCGCTAGGGCGGCGGGTTCCGCC
GGCGTTTTGTTCCGCCTTCTAGCTCCCCCCACACAAAGAAAGTGGAAGCCGAGAAGAAACGTCGAAGGCAAGTGACCAGATCGAGGCGTGGCCCCGCCCT
GCATACATTAGGATTACGATGCATGTGGCGGTTGAGCAGCGGCTTCGCGTGCCACTCGAGTCGCGCTGCACGGGGCGAGAGGGCGCACGCTGCGCTGACT
CAACCCGAAATCGGTTCGCGCCCGCAGCCGTCTGCGGATTCAGTGGCTTTAGCGGGTGCAGCGCGCGAACTCGGAGTGCTGATAGTGTGAAGCGACCCTT
CGAAGGGAGGTACCAGGTCCCGAGCGAGAAAGAGACTGACCGGAGACGCTGCTGTGTTGCTGTGTGGCTTGCTGCAGACGTAACTATCTCGGAGAAGCAC
TAGCAGGAGCAGGAGCAGAAGACGCCACCAGTCTTTCACGTTGCAACGATGAGCTCATTCAAGAAGGAGCACCCGTTCGGTGCGTAGCTCTCTGAGCAGG
TCCACAAGATTCCACGGTCTCAGATTTAGGTTAACGACGTTTGATGGTGCCATTTTTGCAGAGAAGCGCCAAGCCGAGGCCCAGCGCATCCGATCCAAGT
ACCCGGACCGGATTCCGGTGCGTACGCTATAGGTGTTTTCGTGTTGGCTAATCGAGAACTAACTGGCGAGTTTCTCCATTGTGGTGCAGGTCATCTGCGA
GAAGGCGGACCGTAGCGACATCCCGGACATTGACAAGAAGAAGTACCTGGTGCCGGCCGATCTGACAGTCGGCCAGTTCGTGTATGTGATCCGAAAGCGC
ATCAAACTGAGTCCAGAGAAGGCGATCTTCATCTTCATCAACAACGTCCTCCCACCCACCGGTATGTGACCATACCGTGCTACCTTGTTGCTGTCTCTGT
ACTAATTGATGTATATTACTGCGGTTTTTCTGCTTTAGCGGCACTGATGTCGAACATTTACGAAGAACAGAAAGACGTGGATGGTTTCCTCTACATCACC
TACAGCGGCGAAAACACCTTCGGTCAATAGGCGCTGTCGGCGTGTGGGGACTGGATTTTGGTTGAAGATTTTTTTCGTCGTCGCTGTAGTGGACGGTGGG
TTCTGCGCTCTTAAGCTGGGAGTCGCGGTACCGTCATTCAGCATCGGATGTCCAAGCGTCTTTTGCACGAGGGTGATGGCAAACTGAAGCGGGTAAAGGA
GGGAAGCTTGATTGCCTCAGGCTACTCGAAGCGCGACAAGAAGTATTTGCTGCTGCGTGTGGTCCATTCTTCTAAAGCTGGCGATGTGGATATTTTCTTA
GCAAAAATAAACAGAAAAATGCATACAATTCTATTCACTCGCTCGCACCAGTCTATCTTTTGTGCTAACGCTTTCACTCGCGTTGGAAGCTCATCATTTG
CAGACCTTGGCCAACGACCACGACTTCATCAGCCTCTGCAGTTGAAGCTTGGCGAATGGCGAGATCTGCTACATCGGCGCACTCGGAGAAGGCTGCACCT
CGCCATTCCAGTTGAATTTCGTTACCGTCGCGGCGTATGATCCACTTGCTCACTCGTTGATCATAACCAGCAGCGAAAACAACCTGTGCATCCACGCACG
CAACGGTTTTGATAGCCGATCCGCTGGCATTTACTGCCCGAGTCTCCGATAACTTCTGGCACGCTGGGAAGCGCAATTCGCGCAGCAGCAAGTTCTGGTC
GTCTCCGCCGCTAATAAGAGTAACGTCGAGGCTACCTTCCTCCTCACTCTTCGCGCACTTGGCAAGGTTGATGCAGTTCGCGCCCATGTCATGGGCCAAG
TAGTTCCCACTTGGCTGCATGGTGCTGATCAGTCCGAGAAGTTTCGCATTGAAAAGGTTCTTGTCCTCCTGTGATTGGAGAAGGGACGCAAGCTCCTTCA
GCAGCATGCTCAGGTCCCACAGCGTCACTAAGCCATCCGTTGATCCTACTGCCAATCCAGCAATTCCGCCTTCCTCAAATCCAACGCAGGACAGAATCGG
CTTTCTTGAAGTTGAACGGCAGTCACCAAGCTCGTACAGCTTGCCATGATTCACGTCAAGTAGCAGGAGCTGGGTAGACCCCTCGGAGTTGCACGCAGTC
ACAAGTCGATACGCGTCCGACACAGAGGGTATCGCAAAAGTTGCCAACCCAAGAATGCGGTGGTCCTGCTCTGCATCCGCGCGCTCCTGGCCGCAGAGAT
GCCGGAGCAAATCGCTTTCTCCACAAACTAGCCACACATTTAAACGCTGCTTTCCACCTCCCGATAGCACAATATGATCCACGACACCGTCATCAGTTTT
ACGCTGGAATGTTGTGAGAGCTCGCACCGTAGTCGTATGTGCGATCCCAGTGGCCACGCTTCCCCAACGCCAGCTATTGTGGTCACGTCGAAAGCGACGA
CGGTGTAGCATCAGACTATTGTCCTCTGCTGCAGTAACGAGTCGGTCATTACCAAGGAATGCCACACAAGTCGTCATCCGGCCATGATGCTGGTCATGCA
GTGAGCACCTGGAAAATAGCGCGGGCGTCTCCGATAAAGTTGCATTCCCCAAAAGGGTCGAATGCACCTTGATATCTACATGCTGCTTCTGAGTTGAAGG
AGGTGTGAAAACGAACGTGTGCGAGGGCACGCACGAGCCCTTGCCATGAGCACTAGTGAAAAGAGTGTGTGGGCGACGCCATCCTCCACACTCGACATTG
AAGACTCGATACTGAGCTGAGAAATTGTGCAGAACAGCTTGCGCCGCGTGGAAGCCGAACACCATGAGATCCCTCTTCGTGTTGCCCTCGGAAGACGGTG
AGTTCCACCAAAGTTGCTTGACTGTGGAGATGCCTCGGATGGATTCGCGGCCAACCTGTGTAGCCGTCAGCGCTCCACTCACATCTTCTTCAAGCGCAAA
CGAGCAAATATACCCGTCGTGACCTCCCGAAAACATGACAGCGTGTTGGGCTTGGGAACTGTCTACTTCTTCAGAAAGTAGAAGAGATGCCACCAATTCG
CGGCCGTGAACACCCTTGCGCACGACGCCTGCGCTTCGCACATCGGAGATGTTATCGCCACTTTGGCTGGCACCTAGCGGGCGTTGGAAGATATACACAC
TGCCATGTCCATCGCCTCCGATGATATTCCTCGTCGCAGAGCGATCTACCACCAGGATCGATGAGACCGAGCTCTTGGCGGGGATCTTGAACAACGCGAC
CAGTTCCATCGAAATAAACGGTGATATCGAGCTGTCGGTCTGCTCGGCAATAGATGGCTTCCACTCGGAAAGAATGCCACTAGCACTGCTAATGAAAAGG
GTGTCATCCTGATCCCACCACATCTTCATGATCCGGATGTTGGCATGTGCGGTCCACGAGTGCAGCAAAGTGCCGGTAGATGCCTCGACAACACATACAC
GACCCGATACGTCACCAAGCAGCAAAAATCGCCCAGAACTGTCGATTGCAAATGTCGAGAGACCTCCGGTTCTTGTTTGCGCCGGGGCATCGTCAAATGG
AGGAATTGTGAAGAAAAGTTCCGCCGCGAGCGAAGGCAGGTCCAAACGATAGATCTCTCCGTGCTCAGAGGCGACAAATGCAGTTTTGCCTTCCTCTCGA
GAACTGATCACGATGTTGCGCACGCTGTGGGATTGACCCCCCTTCTTCTTTTTCGACACAGTCGTTGGCGCAACGAATGGGACGCGGATAGTTTTACTCC
ATTCGCTAGCTTCGGGCGCATCGGTGGTGGACATGAGCTGGCGCTTGATATCCCAGAGTTTCGCAGCACCATCACCACCTCCAGTCGCAATGATCTTTTG
AGACGGGTGGACTGCTGCACGCCACACATGCCTGCCCATGTGTCCTTGAAATGTAGCTACGCATTTGCCATCGAGACCCCACAGTTTGCACAGGCCATCC
TCACTTGCCGTCACTACGCCGTGCTTCCAAAAAGCAACGTCCCAAATCCGCGCCGAGTGGCCCCAGGACCGGAACACTGGCGAGTACTCCTTTGCAAGCA
ACTCCGACCGGCTTGCTGTTCGTGCTCCTAGCAATTGCTCGACTGTAGGTTGCCCAATGTTCGACCATAGCTGTACTGTACGATCGTCAGAGACGGAAGT
GAGAGCGCGAGCATCCGACGACCATGCCAGCTTGAACAGGACGCCATCGTGAGCATGAAGTCGTTGCGCCGGCTCCACCGCAGGATCCGTGTCGTCGCCA
GCATTTTGCATAGGATTCCAGATCAATATTTGCTGAAAGACCGTTCCCGAGGCCACCACGAGCTTGTCCAGTGATCGTCCGTGGAATGACAACGCGTACA
AAATGCAGCGCTCAGCGCACTGCACGCTGCGCAGAATATTGTTGCGCACCGGGTCCCAGATCTGCACCAAGTTGTGCGCAAGGCCCACTGCCACCAGCAG
CTTCTTGTTCTCCTCCTCCTCTTCAGACGCGAAGTCGTCTGTCAGCAGCTGCACGTCGAACACCCAGTCGCAGAACACTTTCGGTTTCCCGAGCACCGTC
AGCCCTCCAAGCGCTTGCGCAGCCTCCGGATTTTGCGGAAGGTCCTTGAAACACGCCACTCGCTTTTGCCCAAAGAATGCGCCCACAAACGTCCCGGTGT
CAGTGCTGCTGGGCCCATGAAGTCCGACGACGTCGCAGCCGTGCAGAATGCCTCGCGTCAACACGCTGTGCTCTCCCAGGAGCTCGCCCGTAGCAGTGGC
GTACAGGAAAATCGTAGGCCCCACACCCACGTAAAGTAGAGACCCATCGCACGAGAAGGACACCAGCGTCACGGCGCCCAGGAACTCCTGCTTCTTAACC
GGGGGGTGCGCCATCGCATCCAAATTGGACGGTACTTTGAAAGGCGGCTGAGG