Description :
From Genome Similarity Track
Location :
Scaffold_51:57424- 59256
Transcript NameFunction/comments
Hyaar_Emoy2806482hypothetical protein
Hyaar_Emoy2806483AlNc14C6G894

Sequence
1832 bases(100 bases per row)
GGCAGCGATGACGCTCCAAAGAAGAACGAAGACAAAGACCCGATGGACAAGAGGATCGACGCGGCTCTGGGCAACTGCGGTGAGCTCACGCTGGCTGGTA
GTCTCGGCTTCTGTTCGGGCTACGCCTTCAAGTTGGTGGGCAAAGCCGCGGCACTGGCTGTGGGTCTCGTGTTCATCATAGGCCAGGTGGCGGCCTATAA
TGGCTACATTGACATCAAGTGGGGAAAGCTGCAGAAGGACGCGATCGGCAGGGTCGATCCGAACGGAGACGGCAAGATCAATGCTGCAGATGTCAAGCTG
TGGTACCAGAGACTTCTGGCGATCTTGAAGACAAAGCTGCCATCATCCGTGGGCTTCTCCAGTGGATTCGCGCTCGGTATCTACTACTCGTAAACATTGC
CGCGTAAGTGCACACTCGATGTCACCTTCGTCAAAGTACGAGCAGCACCGACAGCAACGCGGTGGAGCGCTCGGATCTACCATTCGTTGGCGTTATAATG
AAAGTCGACACACTTTCTCAACTTGTGTGTGTGTGTGTGTGTGCGAACAGCGGCGTTGTGGACCAGTCGTGACAAAATAGACATCGCATTGCTACAAAGT
GTTGCCGTCTGCCCTACTCGGTTGGGAATGCTTTGGCCAGGAATCCAACGATGATAGACCGATCGTCCGCGCAGCTTACACCCATGCTCTTTAACTCGCG
CGAGAATGCAGGCACGCTGCTGATCCCGTTGCTGATCAGATTGAGCCCCAAGGTAGCATATAAGATAATCTCTGGCCGAGTGAACGACAAGAACGTCTGC
TTGGCGCTGTCGGAGCACGTCGGGAAGCAGTCTTGCCACATTTTCTCTCGTAGTCGAGTCTTTTGATCGTTGTCCGCCACCTGCAGTGAAGGCGCACGCA
CAACAAAACAACTTAGGCTTTTTGACGCGACAAACACCGGCTGTACTCCGGACCCTACCGTCAGAGGTATAGATGCTTGCATTTCGCCTTCATCTTGATG
AGCCTGTAAATGACACCAAGACAAGCAACCGGGAAACGTCATAAGCAAGAAATGCGTCCCACCGTCGACGCTTGCCAAAAAAGTGAAATAGGGGTCCTAC
CGACACGCCCGCATCGTGGAGGTCATGAGCACGCAGCTGCAGTCTTCGTGTAGCCAGCTGCGTCGCCTGCAGCACGCCCAGACAGCAGTACCATCAAATC
AATCAACACCATTCAATCATCCAGCAATAACATCCCCATAGCAGCACGGTCCGAGCAGGACGGCCGATCTCCTTGCTAGTAACCGTACTATCATATCCTT
CTCAATGTAAATCTTGTACGCTTCATTCGTCCGTAATCGTGGCGTGAACAATTTAGGCTTCCACTCCTGCAGACAAAACACACAATCAACCAGCAAATTA
ACCAACCAGTTAGCCAGTAGATCACCTTTCCAGCTCCAACATCAATAGCATCGAGACGTGTCTTTCCTCCTCCTCCTCACCTCGTCCTCCTCCTCGTCCT
CGTCATAATCAAATTCAATCGCCGTGATCCATCCCCTTTCCAATAGTCTCGCCAGAATGTGGCCAGCCATCCGCGTCCTCGCTTCCCCCACGAGCGTCGC
TGCCGTCACCGTCGCCGTCGGAGCTGCAGTCGACGCCGTGCCGTCCACCACGAGGTCAGTGTCGCTCTGTTCGCGCTTGACGGTCGTCATTTGCGTCGTA
AAGAGCTGCACGCCATCCCGCTCCAGCCACTCCCGCAGGACCGTCTCCTCCATGAACTCCATATCGTTCTCATCCGACTTCTCGAGGATTCCGGCGTGCT
CCAGCAGCACGACGAACTCGTCTTCACTCATG