Description :
From Genome Similarity Track
Location :
scaffold_62:57423- 58625
Transcript NameFunction/comments
g2487.t1hypothetical protein

Sequence
1202 bases(100 bases per row)
AAGATCGCGCTTCACAATGGTCGCTGCTTTCGGACGCGTCAATTCACGGTACCGCTCAAAGCTGACCCAAACGGAGGGGATACACTACTTTGTGTACGCA
ACCAGTCGAAGCTCCGGGGCTTTGTGTTCCACCCTAACATGGCCATCGTGGTAGTTCTCCAGTACACTGTTCACTTCCGAATCATCTGGTCGTCCAAGGT
GAAGCAACAAGCTCTTGAGGCGAAAAAGCCGCTTCCTCCGGACGAAGACGTGGTTCTAGTGACGATGGGAGCGCGTGCGCTGGTTCCTAGTGACGGCAAG
AAGCTGTATTTGTACGACAAGTACCACCATGCCACTGCGGTCTCCGCTAACCCCCTTACAACGCTAGGAGGGGTGTTACTGCAAGAACAAGAGGAGCATC
GACGGGTTCTTCACGTGGATCTCCTGTCTGGAGCCCCGTGTCGCCCGTACTCGGACAACACGCTGTACACGCCACCAGACCAGGTAACCAGGTCACTTTC
GACTCGCGAGGTGTCCGCCAAGGACTCTTTCGCCTTTTGCGACCTGAAGATCACGATTGATGAAGAGATACCAGCAATTAACACGCCGATCGAAGAGACT
AAGGCTCCAGCTTCTCCTGTGAAAGACATCGCGGACGAGAGTAACCAAACGACCGAGGAAGATGACGAGTATGCAGCGGATGAATGGGCTCGGAAGCTAT
TGGGGAAAGCTAAGAGCAATCCAGTGTTGGCTCAAACGCTCAATGCCTTGGCTACTTCTCCTACCAAGGAGAAAGTTGAACGTCCGAAGACTCCATCGCC
TACGAAGAAGCAGATTCAGGTCGAACGACCTGGTCCGACGACATTAGTGCCTGATGCCCCCACTTCCGAACTCTCTCGAGCGTCCAAGACGCTGCTCACT
CGTTTTGGCTACATGGATCCACATGATAAGCCGCCAACGTCTCCAAGTAACAACCAGAAGACCCACGACAAGCGGAAACGTCCAAAGACGGTGGAGCTGA
TTGCCAAGTCCATTGAAACTGAGGTGAACGATCCCTTCAAGGCTCACGAGATCCGATTTCACTTTGCAGCGTACCGAGCTTGTAGCCCTGATGCTCAAGT
GGAAGGGAGATACAGTCCAGCTCCTGGTCGAGTGTACTTCACCTTCCAGTTCTACAACTTCCCTCCTACGAGAACCGAGACGCTTCGTCTTAGCAAAGCG
TT