Description :
From Genome Similarity Track
Location :
Scaffold_583:5742- 7898
Transcript NameFunction/comments
Physo_145177reverse transcriptase

Sequence
2156 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCTTCGAGACCACGTCCTGGTAATCATTTACCACTTGATACAAGGGATCCGACGGGTCCTTCAGGATCGCCGATCCGCTCCGCGCATTCAGCGCC
TTCTTCGTGTCTTCCAGGACAGCTTCATCCAGAAGAGAGGACGAGTTCAACTCTTCTTCGGGTCGTATGACCACTACCTCAGCCAAGTCTCCAGCCTTCA
AGGCTTCGCCGAACTCGGCCAAGGACATCTCGTCCGGCTCCAGGAGAGCAGACAGTGAGGGCAAGTCGTCGAGGTTGATACCTCCGTCGACGTCGCCCGT
CACTCCATTCATGAGTGTATAGAGCTGCTCGCTCTCGCGTGGAGCCTCACCGCTCGACACGCCCTTCTCGACTCGTGAGATCGCAGACGCCTTACGTCTC
ACAGCCAGCGCTTTGCGGCGCTGCCTCCTCTTCATGGACACCGTCCGCCCTGAAGAGCTCCGTAATTTCGCGTGCGTCTTGATGCCAGGTGTCACCACCT
CGTTCAGCTCCAGGGGAGCTCCAGTGTCTTTACCGACACTCAGCGAAGAGCTGCATGATCCGCAGCCTCCACTCAATGGATTACGTGCCACTCCACGATC
TTCATCCGGGCAAAGCCCCTTGTTCTTCGGTATCGTGCCGACCGCGCCTTCACCGGCACGCAGCAGGGCGTCGCCCTCAGACGCACGCCCGCTCAGCGGA
ATTAGTGCCGCCCCACATCCTTCAACAGCCGGGCCGCGCCCATGGCTCCTCGGCTTCATGCCGACCTTGTCTTCACTTGAATACAGCAGGGCGTCGTCCT
CAGACGCACACCCGCTCAGCGGAATTCGTGCCGACCCACCTGCCGTCCGCGAGCCACGCTCGGAACGCTCGTTCTCGACATACTCAGTGCCCACCAACTC
GAAGACTCCGATGTCCAGCACATTGACCGACTCGGTCCAGTGCTCGCGCCAGAAGC