Description :
From Genome Similarity Track
Location :
Scaffold_1292:5740- 6978
Transcript NameFunction/comments
Phyta_totarag12645hypothetical protein

Sequence
1238 bases(100 bases per row)
TTCAAGCAAAGAAGGCTAAGTACTACGATACATGCGAAGACGAGTTAACCCTTTCGCGCGACGAGGGCGCATTTCTCGCCCTTTAAGCGTGCTATCATTT
GACGGTGAAACTTCATGCTCTAAAAGGGCGCGTTGTGCGCCCTTTTAGCCCTGTCCCATCTCCTACATACCGTGTTTTGTTACTACCAATTAGAGCAGCT
CATTTGCAAAAGGGCTGGGGTTAGTTTGATAGAGGCGGTATTTTATTGCATAGAAAGCATAATCAGCATCCACGTCGCCGCTGTCACGAGCTGGATACTG
CATCTCGCGTTTGCTACCGTTCATTCGCATCATTCAAACCACAAGATACATGCACTCCACTGATTTTTGGTTGCTCACAATACAATCACCAAGCGAAATG
CGCACAACTTTTACGGACACCGAAGACATAGCGCTCGTCCAGATTGCATTGCAATTCGAAAACGAAGGCCTTCACATTACCTGGGATTATGTGGCTCGCC
GCATGAGAACGAAGCGCCCTGCGCGCGATCTTCGGCTGCATCTAGCCAGCTTGAAGCGCACGTATGGGAGGTTCATTCGTGGGTTTCCGCCATGCTTCTT
CGGTggactccagcagcgacggctcCTAACCGCGCCTGATATACCATCCTCTCCGCGACTCATATTGCATTCACCGCAGCTGCAACGAAATCTACCAGAA
GGCGCAGCGATAGCCACCATCATTGCAAAACGCAGCAGGTATGCGCGCGCCTTGTGGACTGGCTAATACATACGCGGCTCTGACGAAGGCGTCTGTGTtc
gtggtgttgctgctgtagatgcAGTCGGAGATGGTGGCGTCGCTAGCGTCGTCGAAACTATTGGCGGAGGTAGCTCTGCCGGTCCAGCAGTCGCGGAAGG
ACGTGGAgggcgagcagcacgcggcGGACGGGCCGCTCGTGGCGGCTATGGCTGTGCGTTGTGGAACCCTATGCAGGCTGTAGATGCCATAGTGGTTAGT
TTTGGAAGTATTGGTGCTGAAGACGTTCGGCAGCAAGCAGGGCGAGCTTATGATAACGTGGGTGAGGTTCTTCCTTTGGACGTCGCTAGGTTGATCGAGG
AAATCGGACCGGTACGAGGGACGGATGTTTTCcttgatgttgaagctggcgttgGAAACGTCATCGCTCAAGTAGCACTGACGACGCCAACGATACGCTG
CATTGGCATCGAGGTCCGGAGTGATTTATGTTCACTTG