Description :
From Genome Similarity Track
Location :
Scaffold_898:5740- 6857
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_898-snap-gene-0.8Ankyrin repeat protein
Pytir_DAOMBR486maker-pir_contig_898-fgenesh-gene-0.3Cathepsin, cysteine protease family C01A

Sequence
1117 bases(100 bases per row)
CAACGGAGAGACCCCGCGCCAGCCGTACATGCAGTTGACTTGACCATACGCTTCATACGCAGCAAGCAGCTGAGCGATCTCCAGCTGTCCAAAGAGACAC
GCGACCAGCATGGGCGGTGGCACTTCGGAGTTACGAAGAAGCTCGTCGGCATCGCATTCCACAAACCCGCTTGGTAGCTTACGCCGCCGCAGTGTGCTCT
CCTCCAAGAAGCGGATCAGCTCAGCGATTCTCGTGACCACGGCGCGCTTCCAGTCCACTTCGGTGTCTGCAATCGAGTAGCGATCGTGCTGCTGCTCTTG
AGTGAAGTGGTGTTGCACAATCAGTTCGCTCACGCGTACACTTGAAGCGCCGTCGTCCAGCGCTCTCCGCAGCGACTCTAGAAGAGCTGCAGCGCTGATG
TCGCGTATGTCTGCTGCTTGATGGCGTTTTGCTCCATGTGCTGCTGGTGCTGTTCCGTCTGAGTGTGTACTACTACGTGCGTTGCTATCAGTAGAGTTAG
AGCTGCGCGACGTCATTGCTGCTGTTTGTTTTTTGGGGGTTCTTCTCAATCTTCATTTTGCGCAGGAAGCCTCGCTTTCTGATAATCCATTGAGCAAATC
TGATGCTGTACGATTCAGTAGCTGATACTGATCCGCTCAGAAACGAACATGTGGTTGATGCGATTTCCTACCTGCTATGAGAAGCTACAGAGGTCGCGAC
GAGCGGATGTGCATGTGCATGTGCGAAGATGGATCTGTCTATGAAACGTAGACAACTATGGCAACTATCCCAAAACAAGTAAGTGGAACCGCTATGCGTA
TGTGTGTCATCTGATTAGTAGTACCCGACCCATTCATGTCATTGTTGACTTTGTTATATGAGCCTCATAATAATTACACGATCGGCACGGCCCACGCACC
GTGGCTCTCAATGTTGTACGTATTAACGCCGCGCTCGACGCGGAAGAACCCGTCCTCGCCATACTGCGTGCCGTCCGAATTGCGCACGATCCAGTACTTG
AGCCCGTCGTCCGTGGTGCCCCAGCCCACGAGGCTCACGACGTGGGTCGTGCCCGGGTACTTGTTTGAGTCACGCAAGATGTAGCCGCCCTTGAAGTTGC
GGTACTCGGGCGTGAGC