Description :
From Genome Similarity Track
Location :
Scaffold_2087:574- 3245
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2087-fgenesh-gene-0.0RNA helicase
Pytiw_DAOMBR242034maker-piw_contig_2087-fgenesh-gene-0.1Animal inward rectifier K channel (IRK-C) family protein

Sequence
2671 bases(100 bases per row)
CGCGGAAGCTTGAAGTTCGAAGCCATGAGAGAAGCGTCGAGCACTGCCCGACATGGCCGTGTCGACTACAGCTGCTGTGGTGTTGTGGTGTGTGGGAAAC
GAGCGCAACGATGACCGGCGCGTGACGCAATTGGATACCATTGCTAGCAGTGGTGTCCAGACCGTGATCTCGCCGTTTGCTCATCGGCTACTGGTGTCCG
CCGTGTGGAGATGACGTTCAGTTCTTCGTCGAGTCGCACCAAAACAATGCGATCCGCGCGTGGGCGAATCTACAGCGCGTGCGTGTAGCAACGCGCGCGT
TGTGGTATGCGCCTGCGATTGAGAAACACTTGGCTCGCTCCAGCTTTCGCTACCCGAGAGGGAACATGTGAAACAAGCGAGTCGACGTGGATGGAAACGG
AATAATCTCCCCAGCGTTCGACGGACAACCCCAGCTCTCACACCAGCTTCGTCTTCCAGACGGGATCGATTTATTTCAATGAATTTGATCGTCGACGGAT
TCGAACGAAGCAAGCAACTCGACCTCTCGGCGCTCCGTGGTTGCTGTTCTTCTCTTCAGTGCGTGTCCCTGGGGCCATCGCACGCCAGTACTGACTTTTT
TGCTTGTGTGCTTTTGCTGTGCCTCTTATAGCCATACCTGCAGCCTGGTGACGGCCCGATCGTTCTCATCATCGCCCCGACGCGTGAGCTCGCGGTACAG
ATCCAGCAAGAAGCGAACAAGTTCGGCGCGAGCTCGAAGATCAAGAACACGTGTATCTACGGCGGTGTGCCAAAGGGTGGCCAGATCGCTGACCTGCGTC
GTGGCGTGGAGATCTGTATCTGGTACGTTGCCCTTGTGCATGACGATTGGATTCGGGAAATGGTGCCCTCAAATTAACTGGTTGTGTTGCTTCTACTTGC
GATGTGCAGTACTCCTGGTCGAATGATCGACATGCTGAGCATGGGCAAAACGAACCTGCGTCGTGTGACCTACTTGGTGCTCGATGAAGCCGATCGCATG
CTCGACATGGGTTTCGAGCCACAGCTTCGCAAGATAGTGAGCCAGATTCGCCCGGACCGTCAGACGCTCATGTGGTCCGCTACGTGGCCGAAGGAGATCG
TGTCGCTGGCGCATGACTTCTTGACCGACTTCATTCAAGTTACCGTCGGATCGCTGGACTTGACGGCGAACAAGATGATCAAGCAGATCGTTGAAGTCAT
GGACGACCACCAGAAGTACACTGCGCTCATGGAACACATGAAGGACATCTACGAAGGCGGTCGCATTATTATTTTCTGCGAGACCAAGCGTGGTGCCGAC
GAGCTCAGCCGCAACCTGCGCAACAGCAGATACGTGTGCAAGGCGATTCACGGCAACAAGTCCCAGGAGGAGCGTGATTGGGTGCTGAAGGAGTTCAAGG
AAGGCAAGACCCAGGTGCTGGTGGCGACCGACGTTGCCTCGCGTGGCCTCGATATCAAGGACATCCGCTACGTGGTCAACTTCGATATGCCGAAGAACAT
TGAGGACTACATCCACCGTATCGGTCGTACCGCTCGTGCCGGTATGAAGGGTAACGCGCTCTCATTTTTCACGAACGACAACGGTCGTCTCGCCGGTCCA
CTGGTGAAGATCCTCGAAGAAGCTGAGCAGGACGTCCCACGTGAGCTGCGCAACTTGGTCGGTCGTGGCGGTGGCGGCGGTGGCCGTGGCGGTGGTCGCG
GTGGCCGTGGCGGCGGCTACCAGCGCTGGTAATTATTCCGGTGGCATTTCAGTATGTGTGGAGCCATCGTGCGTCGTGGGCGAGCCGAGCCTGCCAAGCG
CCGAGATTGAGAGAAGACTGAGCTCCAGAGTTCCTTCAGTTCGAATCAATAATTTGCATCAGCGTGGATTTAGCCAGTGAGTGCGGCCCCATATGAGCCC
CCGACTTCCAAAGACGCATCCAACCCTCCCCTTCTGACTTTGATCTTCTTAGAAAAACAACAGCATCTAATACACGTGCTTGCATTGAAATTTGTTCATC
TTCCAACGTAGCTAAGCGTGCGTGTGTGTGCGTGTGTGCATTAATGTTTACAAGCCCATGTGCCATGCATCTCATGGTGAGAGAGAGGAATAAAATAATC
AAGTGATCTATCTACAAATACAAAAATTAGCGTTCGAGGCCATCGCCACCACCATGCATACTACAACGAAGACGCCGACATGGGAACTTCGGGCACGAGC
CGGTCGAAGCGCTCGTAGTCGACGATCACACGGTCGCGCTCGACGCAGGCAAAGTCGTCGAAGCGCAGGTCGACCGTAAAGTCGTCCCAGAAGTACATCT
TGCGCGCGTACACGTTCTCCGAAAACGTAGTGTCTAGACCTGTGAGCAGCGCGATGACGGCCACGCGCGACTCGGAGAGGTCCTCGACGGTCTGGAACCG
GAAGAACGGCGACGAGCGGTCGATCACGTGGATGAGCGTCGCCGGGAGCTTGATCGAGGGCCACTCGGCCGTCACGAGCGGCACGTCGTACATCTGGCGC
AGGCCCGTCTTGCGATTGGTCAGGATCACGCCGATGCGGAAAAAGTTCTCGTGCACGTCGCCGCTGTGGCGCGTATTGGCCGCGCGAAACACGAGGCACC
GGTGACCGTAGATGCGGCAGATCGCGATCTGGGCTGAGAAGTGGATGTGCGCGCGCGGGCGCGCAAACTTG