Description :
From Genome Similarity Track
Location :
Scaffold_748:574- 2465
Transcript NameFunction/comments
Phyag_g7838hypothetical protein PHYSODRAFT_554581

Sequence
1891 bases(100 bases per row)
GTTGGTGTCGATGGCAAAGCATCCGATCTGCATGAGACGGTCGAGACGGTGGTGCCGTACGCACCTCAACTCCGCTGACGTCGAAGCAGACTTGGCACTG
AATGGGACGCCCTAGTTGGTGAGAAGGAGCAGCGGCAAGAGATACCTACGCCTCGAGACCACCAATTGGCAGAACGAGACCTGCCACGGCCAGAGCGTCA
CGGGTGACAGCTCGCTGCGCGCGGTCGATTGGCCACTTTGGCAGTCCGGTTGTGATTATCTCGCGGAGGTACCAGCGACCGTGACAACTGAAGATCGCtg
ctttggtgcttggtgtgcCGTCTCGGCCAATGACCGcgcgaagttgaagacgaacgCGTGCGGATTGGTCAGCGTGATGGGTAACTTCACGGTTGTCCGC
CCTTGCCAAGTCGCAGCGCGCGAGACGAGGCTGCGCCGCAAAGGGAGGACACCGGTGTCCCTCACCACCGACAGCCGCGCGCAACACGGACGCTCATGCG
GCTCACTTGTCAACTTTCCGCCTCCGCGTCACTCGACCACCACGCACGACAATGTCCACTGGGCCCACTGCCACGATGAtgaccaccgccaccgcccCGA
CAGACATGATGCCGCACCTGCAGCCGCTCTCGCCCGTGGCCGTCACACCCACGCGCTCGTCCAAAGCCTCGGAGCCGCTCTCATTCCTGGCCAAGATCGA
CCGCGTCGAGATCAACCGCACAGTGGAGCGCGACGGCGTCGTCTActacgtgctggacgtgttccTCGAGCACAGCACGTCGCGCATCCCGACGCTGCTC
AAGGCGGCCAAGGCCGTCGCCGCGTCCACCGGCCAGCCAGACTACCAGCTCGAGCGCCGCTTCAACGACTTCGCCGACCTGCGCTATCAGGTGTGGACCT
ACGCGCAACGCAAGCACGAGCAAGGCTGCACGTGCAGCTACTGCGACGCGTTCATGAACTACATCGTGCACTCGATGTCGCAGCCGCGGTTGTTTGTCAA
GCTAGCCACCGGTGTGGacacgcgcaagaagctAATGACAACGTTCTGCAACGAATTCATCGGTATCGCGCTCGGCGGCAAGACGGAGCCGAGGTCGACG
CGCAATGTGGAGTGCGACGGCTTTCTGGCCATCCCGTACTTGGTACAGCGATTCTTCCAGAAGGAGGACGCATAAGAAGCACTCGACGACGCCGTACCAT
ACTCGTATTTATTTCGCTCGGCAGCTTGCAAGTAGTGCTGCGAACGACCCGTACCTTGGTTATCATGTGTAGGCGATGACTGCCGACTAGTATCTATCAA
CTAAATCGATATCACCCCTATTAACGAGTTTTCCATCACTCGTCTTCCTTGTGTGGGCGAACCCACTCTGAGATTGATTGTAGTTTTGCTCGACGACTGC
ATCGGTGTCATCGCCATGTTTGTTTGACACCCGAGGTTGGTCAAGTTTACGTTTCACGGCACGTCTGCCCAATGAATGATATCTTTTGCAGGAGGTATGG
CTGTCAGCTTGTGTTACAGGCACAATAGACTCGCTGCATTCCCACGGTGGTTTTGCACGTACTTACTTAATTTATTTGTTACAGCTTTTGTTTTCTTCTT
AGCAAAGATCGATTGTGTTTCTACTTGCGTTcctactgctgcagttgactGTCACCACTCTCGAGCGTGGGAAGCCACAGTTTCTAGGATAAGCTGTTGA
GATTTGGTCGAGCAGGGCCGAAAACGAGCAAACCAGCGAATGGGAGGGTCTGTAGCCTACGGTTTAGGCACTGTCGGGGCATTCCACCCACAGCTGTCGC
TGCGCACCAAAAGTAACATGGAACGAATCCTAAATGTCTTCTCCTTATGGCAACCGAATGCAAAACGTCTCAGCCCTCGGGTCCAACGCCG