Description :
From Genome Similarity Track
Location :
Scaffold_5:573808- 575433
Transcript NameFunction/comments
Phyci_1591Hypothetical protein

Sequence
1625 bases(100 bases per row)
cttgctcctcctcactgctatccgcttcctcctcttcttggacgacgtatgctcggccggaaagttttgggcggaatctgtcgtccgggatgttatctgc
tcggaagtcccgtttcggaggcggagcatcgaagtcatcatgctgattcatcgcttcgtgctgcatcaaaatgtactccacatccttcaacctgcgcatc
cgctgtccttgtagagtagaacggaggcgtgagtccaagagccgtttagtgagcactttcaggtgtcgctctcgcatcttgctcgacgatctgaagtcaa
cgccagctttctccgcaatcttgtttaatcggtagtaaaattccagcagagcgtccgacttcttttggttcatcgtgtaatatcgttccgcacccgaagt
cttggctttacagtacatctcccggaaagcccgcaaatatcgtttccacccgcgacgttctcttacatccaagtttgcacgccaatttcgaacagacgga
gacatcttcagcttcatcgcgtagattttcactcgatctgtcctgcacggcgagacattggaatcgctccaaccatcggatccgggaggccagtggcgcc
ttctcgtcgcaatcctgcagtgagcatgagctaacgtatggacggaacgtgtagaccgtgtctgcgtctgacgtcttcatggctacacccgaggtggcat
cgccaaaagaactgctatccgaactgtccgagcccgagctgtcgctggagtctgagcttgagtcggagtctgatggattggcatcacagcgcgagcttcc
atacttcttcttcgcagtggacgttttctttcgagaatcggcgagcTTGGATGTTACTGACGACGACCTTGGAACTGACGACCGACTGGGTCTAGGCTTT
TGAGGCACGGGGGGACTCGACCTCTGGTAGTGGTTCTTGCTTCACCGCCGGTGACGACACCTTGGGAGCCTGCGCGGCATTTGCCTTCGCAAAGTCCACT
GCTTTATTCgtacttagcgtcgcctgcagttgagacgccaagagtccgtctgagccctacgtgtctcttcccacatgtcccgtgtttacgccacagttga
ttacgccacctgatccttaactggattctttgtccaaagtcacacgatcggaccgtttctgtcgttgagttgctgtatcgggcttgattttttgcacgga
accttgattgcttgtcgatgctgcacgaagatcgcgcagttgtcccaagaggtatttctgcaaattcttcgcggcttcacgctcctggtctcggtcgacc
cgcaggtcctgcaagtcgtgccgttcagcgtcatgagcctggcgggattccaaatgggcctggttatgtctaagcagggcttccaagcgttcgcgttcag
ctcgtgcggctcggagcgtttacagagtctccgcctcgcggcggttttgactggcgtcgtgaagactcggcgtgacttcggacttcggcccgatctcgag
agctggccttgaattatccgtccaagctcttccttcagcgcttggccaagcttctcaagcgtcgacccatgggtgcttgccaaccgcgcgaccgcacttt
ggactccgcgcatcgtgttcaaggc