Description :
From Genome Similarity Track
Location :
Scaffold_115:5736- 7312
Transcript NameFunction/comments
g2586.t1hypothetical protein
g2587.t1OWZ00441.1 reverse transcriptase, partial [Phytophthora megakarya

Sequence
1576 bases(100 bases per row)
CCGCGATCGTTTGATGCGACAGGATGGTTCGCGGAGTTCGTACAGTTGTACGCGGCATTCGAAGAGGAGTTTCGTCAAGCATTCTGGGAGTCTACCCACA
AGCTACCGATCACCAAGGCCATGAAGTTGGCCAACCCTTTTCTGGCTAAGTTTTGGCTCGGGTGCAAACAGCGTCGATCTCGCGCTGGTCCCCGGTGGCA
GACCATCCTCAAGCATCTACTGGCTGGGATGATCGCTGGACACTGCGATCTCGACCTGCTTCTGGATCCCTTCTCCCTTCATTTTCCGCGCCAAAACGAA
CGGTGCTTTTGGTACCCCGGTTTCGGAGCCACGCGGGCGCCTCCTGACTTAATCAACGCCCTTCCTACCGCCGATTCTGCCGACCCGTGGCGCAACCAAT
ATCGCACACAACTGAGCGATCATCCCGGGTCCCGCATCGCACGCCTAGACGGTAAGTTTCGGTCCATCGTCGATTCTGAGTGAAGTAACCCTCTCCAAGG
TCTTGATAAGCTTCTGCAATACATTCTTTCTCCTCTCTTTCCCTCTTTATTGGGTCACCCGACCCCGATCGGCCTCTTCCTTCCCCGATCGCAAACTCAC
AAATCACAAATTACCCCTTCCTCCGATGTGCGGCCATCCCGCACATCCTTCATTCTCCTCCTCCCCTACAGTGCCTGTTACTGCAGGGGGTCTTCCGCTT
CCCCTTCATGGGACTGCATCACCTCAAATCTGTTCCGGCTGGCCAGTCCTCGTTCAAAATCGCGCAACATAGCGCCGCAATTAAGGTCCGCCTCATCGAC
CCAAGTTGGATCGTCGTAACCCTTCCAGAACACCAGAAAATCTCGATGGACTCGTCCGTAGCGCGTCCGGCGGCCTGTTCTTACATCCGCGATCTTCTCC
ACTTCAAACTCGCCTTCGTCGAGTGGGGTCTCCCAGCTGTCCTCCGGCAGGAGGGCCTCATCGAAATCCAGGCGATCGCTCTCAGCCACAAGCAACGGTG
CGTCAGGACGATCGGGAAAACTCCGGACCAACTTCAATTTGGACACATGCACGATCGGGAAGATCCTATACTCCGAACCCGCGATCTCAAGACGTGCGGC
GTGATCGTCGATCATCTCGGCGACACGAAAAGGTCCATGCCACAGGTGTGCAAGTTTCCGTGCATACCCCTCCTTGACTCGATCGAGGTGTAGCCATACC
TGAGCGCCCACCGCAATGTTGTGGGGTCGCAGATCTTCGTTGTGTCGGTTGGCTCTGCCTCTGATCGCCTCGCGCAGTCGCTCACGAACCTGTTCCCGCG
CTCGCTGGTAGTGTTCTTGTACGTGGTACCTCCATCGACGGGGCTCCTGATCACGTCGGCGCGTGCTGCCTAACGGTAGCGCTGCCTCCAGTGTCGATCG
CGGGTCCCACCCATGGGCCAAGTAGAATGGCGTGTCGCCACGAACTCGATCCTGGGCCGTGTTTAGAGCGAACGTGAGTCGCTCCGCGTACTCGTCCCAG
TCTCTCTGGTTCACGTCTGACACGTACATCTTCAGCGATCGCGTTAGAGTCTGCACCATTCGTTCGGCAGTTCTGT