Description :
From Genome Similarity Track
Location :
Scaffold_158:57359- 59599
Transcript NameFunction/comments
Physo_143918reverse transcriptase

Sequence
2240 bases(100 bases per row)
GCTGCTTCGAACGCAAGTGTTTGCCACTCCCGATAGCGGTTTGAATCCTTCCTAGCGAATCCAGGTCGACGCGGGATCTGTCCAACGGGTAACCAGATTG
CCAAACACACCAAACGATCCAGTACCAGGCGGCTCGTGCTGATGTTGGTGATCCGGAGGTATGACTTGTTACTGAATCCACCAATCACCACCGTGATCAC
CCATTTTTCCCCTCTCGTTACCCACAGTTCAAACCGCTTGTTGTGGGACTTGAGTGAGATCTCTGTCCATTGGCCAGGACCGACTTCATGGAATCCCGTT
GCGTAGACCGCGTCAGCCTTGCTGCTATACAGTGGCTTACGGTCGGTCATCTGGATGCGAACTTCGTCCGGCAGACAGAGCGTTCCGTCAGCCAGGTCCA
ACCTCACCCCCGCAGGAACCATAAAATCCATGCCGAGAATGACGTCTTGTCCTGAGAGATCTCCAACCCACACACGGAACTTGTACACCAACTCTCCAGC
CAGAGTGAGCTTGACTTCTGCTCGGCCTTCTGTGCGGTACACAGCATCCCCCACACCAACACAATCCATTGTCTGTGTTGTATCAATTTCACAACCCACC
TTACGTGCAAAGGTAGAGTCGATTATCGACAATTCGGCTCCAGTATCAAAGAGTAGGACGGCACGGACATTGTTGACCGCACCGGTCGCCTTCGACTGCT
TGAACCACTTGGACGGAGTGTAATACTTCCAGTAACCTCGGCGTTCACCCGGCGACAGTCGAAGGGCCATCACACAAGGGCGACGCGAATAGTCATCTTC
ATCCGAGGTAAGAGATCTGGCTGTATTCACCGCATGACAGGAAGTTGGGTCTTCTAACACTCGCGCCTTCCTCTGAACATATGCATAAATGCAGAACTTC
GATCGCTCGTCACGTACCAGGCTGTTCAGGCCTGGCGAGCGGTCTAGTTTAACGCCTTCTCGACGCTCTCGAACAGCAGTCCGGCATGGCGAGTCGGGTT
GTACCATTGGCGAACAGCATCGAAGAAGTCGCCGATTTTACACTGACCTGCTTCGTGAACGTCTCCACAGCACTTGCAGACGTAGAAGCACTTGTCGGTA
GGATGGCCCATGCGTCCACACTTCTGGCACGTGAGCCTTTTCCAGCACCCGAGATCCGTATGCTTGCGAGATCCGCAGTGTGAGCATCGAGTGCCGTACT
TCGGGCGCCCCAGTTGGTCTTCGCGGTCTTGGCGCGCCCCTGGCTGTTCACCATCTCCCTGTGTAGGCGTCCTAGCTGCCGAAAACACGTGCGCTCTTTC
TTCTTCAGATTCGCTATCGGAACTGTTTGATTCGCCCTCGAACTCGTTGAGACCTTCGTGATCTCCGCGGCGTCCGCGACCGGTAGTCACAACCCGCACC
GCCCTCGAGGAGGCTGCAGGGGCGGGAGCCTTTTGGCGGTATTTCGAACCTTGGGTCTCAATCTTGCGACGTTGGTGGCGGCGTCGCATGGCCAACAGGA
CGCCTTCGAGAGCTTCTGAGTCAGGCAGCCTCAACACTACCAGAGATCCGGCGAGATTGTCATCTTGGACTGTATCGATGTAGTGGTTGACGTGTTCACG
TCGTTGTTCCTTGGTGCCATCATGGATCTTCAGGTTTGCACGTATCCCGGCCAGATTCAGCCGGTATCAGTAATCCAGTGGGTCTTCCTGACTCCCGCAC
CGCATGTGGTAGTACTTGCGCACGAGGGAGATCCCTTCACCGCAAAAATGGATCTGGAACTGTTCACCCAGGTCAGTCCACGACGCGCGAGCGGTGCGGC
TCAGCTGGTAATACCAATTGCGCGCAGGGTCTATCATCAAATCGGCAAATGTCAAGCACATCTCGTCTGGCTGCATCTGATCCCGTCGGAAGCCGTTCTA
ACCTTGTTGGACCAGGCTCGGGCGGCTTCTTCGTCATGTTCCTTGCCGCTGAAGTCCTTCAGTTCGGACAAAGCCGATGCTCGCAACCTAGTCGCCGTGG
ACACAGCTGCGACACGACCTCCGGTTCCGCTACCTCCATCATAGCCGAGGTCATCGGATAGGTCATGGAGATCTCCTTGGTATTCCGGTTGTGTATGGGA
TTGGTACTCGATACGTGGCTGAGCGGGAGACGCAGTGACTGGCTGCATCTCAACGTCTTCAGGCTCGTCTCGCTCGTTCGCGAACTGGTAAAGAAGGTCT
TCAGCCACACCGCGGGGCGATCGGGCTCTGTTGCAACCTC