Description :
From Genome Similarity Track
Location :
contig_46:57353- 58854
Sequence
1501 bases(100 bases per row)
CACCAAAACCCCCACCGACATCTCGACGCCTCCATTCGATGGTAAAAAAAGTGAAGTTCCAGCACAAAGTTGGAGACAAAAGCATCGACAGTAACTCAGC
GGGTCTCAAGGAGGGAAGTAAAGCACTTTTCATGCTTCACTTGGGACCCGGAGATATCTACGGAGAGGAAGTCACTGCTCCTAATGGTATTTTTCGCAGT
GTGCACGACATCTACGCAGATACCACATCACCTAGCAGCCCTGGGAAAACGCCCGAACTCAAACGATCCCAGCCATCTCTGCTGGGGACAGAAGTACTCT
GCTTAGATCGGCATGTGCTGCATTCGATTCTTGCCAAAACGGAAGAGGAAGCAGCAAACGAATTAATAGGCAAGTCATCAAATGCAAAGGCACGATGGCA
GACCGCGAGCAAGAAGCTCTTTAAAAGAGCCTCGCACTCAACAATCGAAGAGCCTGGAGGGTACATCGGAACGAAGAAGACGCCGAAGTTATTCGACTTC
TTCAAAAATATTTTGAACCAGCGACGATTTCTCACGATGGGGACTATAGCTCACTTTCCTGTACTACGAGACTTATCCGACGACGCTCGACGAGAGTTAT
GCCTCAATGCGCGATTCGAAGCATTAGATCGGTATACTGACGCGTACAAAGGCAACGGGGTTGGCAATGGAACCGGTCACCGCTTCTTTCTGCTGTTGAC
AGGGCGTATCAATCTCGTTGCCAATGGACCAAACAGCCATATCGTATCTCAGATTTCAAACGCTTCCAACTCCGATCACCATAGTCTTGGCGAGGTTTCT
GCAGGAGAAGGTTTTGGTGAGTTTGAGATCTTGATACCTGAGGCACCCGCCTACATAGCCGCAATTGCTGCAGAACCTACGAAGCTTTTGTCGATTCCTT
CGGAAATGTTTTTGAGGCATTGGCCATGCACGAGAGAAGCCCGTCGTAACATTGGGTACCTGCAAACGCAGATACCGTCCTTTGCCGCGCTTGACCCTGA
ACGGATTGCATATCTCTACCACAGCTTTTCATTCGAGACACACATTCGAGGAACCAGTAAGTTTGTATTTTCGATCAAGCACCTCTCACTGCCATCACTG
CATCACTCTTATGCGTTGTTTGTTATTTTTTGCACAGCCATTTTCCAGCTCCACGACATGAAGTCAAATTCAGAGTCGACAAAGGAGGTATACTTGATCA
AGGAGGGTACTTGTTGCATCCGCCAACATGTCACCTTGATAAGTCGTCCAGACGCTGAATTTCACTACGATCCATGCAATGATCACCGCCCAGGCACTCT
GAATGCAGATTCCCAACTGTCTCGAACGAAGAAGCCTGCGAAAACCATTAAAGTCTTGGCGACTGTGGCAGACGTTGGTGCAGGACACGTTTTTTGGAAC
GATACAGATCACTATCCGATTACTTTAGTGGCAACATCAGCTGCCGTTACGATAGCCAGCATTTCTATCGACAAGTTGAAAGCGATCGTACCTCGAGGCC
T