Description :
From Genome Similarity Track
Location :
contig_46:57353- 58852
Transcript NameFunction/comments
g9573.t1ETI50153.1 hypothetical protein F443_06222 [Phytophthora parasitica P1569

Sequence
1499 bases(100 bases per row)
CACACCAAAACCCCCACCGACATCTCGACGCCTCCATTCGATGGTAAAAAAAGTGAAGTTCCAGCACAAAGTTGGAGACAAAAGCATCGACAGTAACTCA
GCGGGTCTCAAGGAGGGAAGTAAAGCACTTTTCATGCTTCACTTGGGACCCGGAGATATCTACGGAGAGGAAGTCACTGCTCCTAATGGTATTTTTCGCA
GTGTGCACGACATCTACGCAGATACCACATCACCTAGCAGCCCTGGGAAAACGCCCGAACTCAAACGATCCCAGCCATCTCTGCTGGGGACAGAAGTACT
CTGCTTAGATCGGCATGTGCTGCATTCGATTCTTGCCAAAACGGAAGAGGAAGCAGCAAACGAATTAATAGGCAAGTCATCAAATGCAAAGGCAAGATGG
CAGACCGCGAGCAAGAAGCTCTTTAAAAGAGCCTCGCACTCAACAATCGAAGAGCCTGGAGGGTACATCGGAACGAAGAAGACGCCGAAGTTATTCGACT
TCTTCAAAAATATTTTAAACCAGCGACGATTTCTCACGATGGGGACTATAGCTCACTTTCCTGTACTACGAGACTTATCCGACGACGCTCGACGAGAGTT
ATGCCTCAATGCGCGATTCGAAGCATTAGATCGGTATACTGACGCGTACAAAGGCAACGGGGTTGGCAATGGAACCGGTCACCGCTTCTTTCTGCTGTTG
ACAGGGCGTATCAATCTCGTTGCCAATGGACCAAACAGCCATATCGTATCTCAGATTTCAAACGCTTCCAACTCCGATCACCATAGTCTTGGCGAGGTTT
CTGCAGGAGAAGGTTTTGGTGAGTTTGAGATCTTGATACCTGAGGCACCCGCCTACATAGCCGCAATTGCTGCAGAACCTACGAAGCTTTTGTCGATTCC
TTCGGAAATGTTTTTGAGGCATTGGCCATGCACGAGAGAAGCCCGTCGTAACATTGGGTACCTGCAATCGCAGATACCGTCCTTTGCCGCGCTTGACCCT
GAACGGATTGCATACCTCTACCACAGCTTTTCATTCGAGACACACATTCGAGGAACCAGTAAGTTTGTATTTTCGATCAAGCACCTCTCACTGCAATCAC
CGCATCACTCTTATGCGTTGTTTGTTATTTTTTGCACAGCCATTTTCCAGCTCCACGACATGAAGTCAACTTCAGAGTCGACAAAGGAGGTATACTTGAT
CAAGGAGGGTACTTGTTGCATCCGCCAACATGTCACCTTGATAAGTCGTCCAGACGCTGAATTTCACTACGATCCATGCAATGATCACCGCCCAGGCACT
CTGAATGCAGATTCCCAACAGTCTCGAACGAAGAAGCCTGCGAAAACCATTAAAGTCTTGGCGACTGTGGCAGACGTTGGTGCAGGACACGTTTTTTGGA
ACGATACAGATCACTATCCGATTACTTTAGTGGCAACATCAGCTGCCGTTACGATAGCCAGCATTTCTATCGACAAGTTGAAAGCGATCGTACCTCGAG