Description :
From Genome Similarity Track
Location :
Scaffold_1:5735209- 5740528
Transcript NameFunction/comments
Physo_310792Hypothetical protein
Physo_248463lectin putative
Physo_472363cyclin G1, isoform CRA_a
Physo_479527lectin, putative

Sequence
5319 bases(100 bases per row)
AATGGGTCTGAGGTTGCGCCAGCTCCAAGTGCTGCACCGCCACGGTGACCGTACCCCGCTGCATAACGTCTTCCGAGGAAGCGTCAATGCGCGCTCCGAG
GAGGAGGAAGTGCTGCTGTGGAATCGCCAGCTGCCGACAGCGACGCAACTGGCCCAGTTTCGCTCCAAGTTCAGTGTTCAAATGGACGGTGACGTCCAAG
CCTCCTTCCAGCAGCGGCCGTTTGGGTACTTGACGACGCGAGGTATCGAGCAGATGACGAGGCGTGGAGACCGATTGGTGAGGGGCAATACAAATGTTGA
GCATGGGCTTGGCAACAGTTCTAGGGGGACTAATGAAATCGTGTGCGTGGTCCTGTGATGTGATAGCGAGAGTTTTGTCAGCAAGAGGACCTAAGCCTCG
ATGAAGTGGAGCCTGAGCTGGTGCAGATCTTCAGTAACTCCTACACGCGCACTCAATTGAGTGTGCAGGCGTTGCTTAGTGGCATGCTGCGTGATCAACC
TCAGTTAAGCCCTCCGGTGAGCGTGCTTCCTCCGGAGAAAGACATCATCAACAGTGAGTGCTTTTTCAGTGCGAGATCGAATGAGTTGGTACTTGCTGAT
TGAAGGGTTGATGTTGGTGGCATGATATTGTTGCACTCAGCGTACGGGATTTTTCCGGAGATCATGGAGTTGAAAGCGGATCTGGAGCGAGACAACGCGG
AGTTTGCGGCGCGCGAACACGACATGGCCCCCGTCAAGCAAGAACTGATGAGACTGCTCCCAGCCATCGACTCGAAGCAGATCCCTTTTTCCTGGCTAAC
CGCAGCCGACTATTTCGTTTGTCGTCGGGCTCACCAGACCCCGTATATTCCGGGAACTGAAGTCCATGGTGATGCCACTGAAAGGCACCTTGGATTCCGT
TTCCACCAGGTACGGGATACATTCGAAATGTAGTCACAACCAGCTTGTGCAGCTCTGACCCTCTAACTGTTGTGTCTGAAGTTTTACTCTCATCGGACGA
TTTTGAAGCTGGTTGCCGGTCGCCTAATGCACAACGTACTCCGTGAGGTGGGTTGAATTTGCCTAGGTGTATGAAATACTGAGCGTGCTTTTTTAACCTG
TAACTGTTGTGGCGATTCAGATGCAAAAAGCTCTCTGGGATCACAGCGAGTGCAAGAAGATTGTGATTTACAGCGGCCACGATGTGTCGCTGCTATCAGT
CCTCCGAACCATGGACGCAGAAATCGCAAACGACATTGACTGGTGGCCCGAGTACTCCTCAGCCCTTGCGCTGGAGTTGCTGGAAGACGGGAACGGGAAA
TTTTTCGTTCGTGTTCGGCTGAACGGCGAGATCCTTGCTATAGGCGATGGGCCCAACGGTCTTTGCCCCTCTGACCGGTTCCGTGACATGGTGTTGGATC
ACATCGGAAGCCATTCTGACTAAGCTTTCGCTATCTATTTGACATCTGTGACCAATGATCAAAATCACTGCTGTAGAGCAACACACACGGCAAGAACTGA
TGCAAAAATAGGCATTTTGTTTAGAGCAAAACTAAGCCAAAAGCTCCGCCACTTGCAGTGCGCGCTTGTAACGTCGACGAGCAAGCTTGATACTGAGCAT
TTTCTCCTTCTCATCAGCTGCGGCGTCTTCTTCATCCTTTGATGGAACTCCAGCATCGATGACTTCTTGCGCCGATTCCATCACTCGCTGCAAATAGAAA
ACACACACACAGAGCTCAGCTTCCTACAGGAATTCTACCAGTATCCAACGCATCTGTTAGGCAGTACTCACCGTGCGAGCGGCACCCTGGATACCGTTCA
GGTATTCGAGCACGATAGCAAACATAGCCTTGGGCACGACGTCCGCCTCGTACATCCACTGCAGGATCCACTGCTGTTTGATTTTCTGCATTGCCAAATG
CAACCACAATGACAGCAATGACAGCAATGACACAAATGTCAGCGGCTGCAAACTCCACCCTACTGCCATGGTGCACTGCGGATCCCGACCCACCTTAAAC
TTCCACGGCAGTTCGTCATCGGCCTTGGTCTCGTCGCGCTTCTGCCACTGCTCCAGGTAGTACTTGGCCTGCTGGATCATCTCCGGAGAGCGGTCCGACT
TGCCGCCGCCCTCCTTCACCTCCTCGGCGTCCTTCTTCTTGGCTGCACGCGCGCGTTTCTTGGGCACGACCTTGTCTCCATTGTCGTCGAACTTGACGTG
GGTCTTGGCCGTCTCCTTCTTGTTCTTGGCGGCTTTCAGCTTGCCGCGCTGCTTCTTGGACGGCTTGGCGGCGCCCATGCTTGTCGGATAAATGACCGCG
TCTGCCAACCAAATTCTAGCGACGTGTGGGAATGGCGTGGTGTACATCAAATTTGAGACAGTCAACGATTGGCGGAATCTTGAGTCTAAGACATGTGATT
GGCGGATATATCTGCATGCCGGTTCGAAAAAACCCGCGGAAAATCGTAACGGCTGTATCTAGCACGCGCCAAAAATCGTCAATGAGCTCGCCACTGTAGA
CGCGCCAGTTCTCTTCTTGCGAGCGAACGGACAGTCCTCAGCTCCCGTCCCTTTTGTCACTGCAATTGCTCGTGGACGCCCGCAGCTCGCCAGTAGAGTC
TCCGCGTTGGTCGTGTCCTCCTCTATAGAAATGTGCGTCAATCGCAAGCGACCGCGCCGTGAGCAGCTACGCAGTCCGCCTCCGACGACTCAGCACCTGC
AAGCCGACGATGATCAGTTGAAGCGCGTTAGGACGGCGTCCCCCACGTCTGTAGACCGCGTGGAAGTAGCAGATAACCAGGCACAGGAGAACGAGGAGCT
CGCAACGGCTGCGCATCGTGATGAAATGGTGGCTGCTATTTTGACGATCACGTCGGCGCTGGGATTATCAAGGGAGACGTTGCACTTGTGTGTGGGCCTA
CTGGATCGATACATGGAGCAACTGGTCGTTGAGGCGGTGAAACTGGAAGCCCTGAGCATCTCGTAAGAACCATTTCGCTGCGAAATATTTGGGGACCAGA
AGCTAACTCGTTTGGCTTCCTGTTGGTGAAACTACAGATGCTTGTGGATTGCAGTGAAGTTCGTCGAGACTCCGACGACTATTTTCGACAAGAGCATCAA
GGAGATTCTCCAGCGACGGAGACACTCCAGTAACGTAAGTTGCATGAAAAGTGGGCTGTTGTGTTTGAGTAGCGCGCCAATGAACTTATCATTGTGTTGG
TTCATGCTTGTTTGTTCACAGTGGACGTGGAATGAGATTCTTGAGCTCGAGCTGAAGATCTTGCACATCCTGGACTTCCGAATCATGACTCCTACCATAC
TCGACGTTCTGCAAAGGAAGCTCTACGCGCTTCAAGAAAACAACCAAGGAGACGACACGGATGCTCTTTCATTCGAGCAGTGCCAGCTAGCTCTGTACTT
CGCTGATTTACTGCTTCTCAAGGCGAGGTCCAACCAGTTTTTGAAAGAGCTTCTCGTGGACGCTATCTGGTTCGTGGTGTCGGGGAACCAGATTGCCGAC
GTGAAGCCGCCGCTGCTGGAGCCTGTCGTGCTGCTCTACCTAGCGCACCGTGACAACATCAACCCAAACCACGCAGTGTTTAAGCCGTGGTTCGCGCTGC
GCTGCCGCTACGGCACTTTCCTGCCTTCCCCGTGGAAGGTGCCCTACGATCCGTCCTGTGTATGCCGTGTTTGCGAGCACGTCAAGGACGAGCTGGCATC
GTGAGCCCAGGATTGCCGCTAAGCTACTCATTCAGATCGATGTAAACCCTACTGTAGACCTAACGGTAACGTATTCGCAAAACAATAGATGTACCATACC
AACCTGAGATCGCAAATGACATGATGCCCGGTAAAAGACACGAAAACGAGCTGCCATTGACCCAAAGGCGATTCCATCTCCTGGCTGCGGCTGCACCTAT
TGCCATTTCTAATCTAACACTGGTGCAAACTGGCAGGGGGAATCTTGTAGTTACATAACCGCTTACAGGAAGTGCGTCTTGCGCAGGTCCTGGTACTTCT
TGTAGCCAGCGGCCACAATGCCGGCGACAATGAACAGAATGATAAAGAACGGGGTCTTCCAGCTACTGGACTTGGCTGCCGTTTCCTTCACGGTCTCTTC
AAGCTGGGTCTCCACCTGGTCGCGAATGGCGTTCACGGTGGTGTGCACACGCTCGACCACCTTTCCATTGGCCCAAGCCTCGAGCTCGGCAATACGCTTT
TCGTCCTCGACACCCTGCTGCTTCAGCTTCTGGATCGTGTTTTCGGTAGACTCCTTCAGCGCCGTAAACTGGTACTCGAAATCCTCGAGCAACTGAGCAT
ACTTCCGCTTGACCAACTTCATCTTGTCGTCGTTGTTGCCCTTGCTCAGGGTAGCCTCGAGGTTCTTGTCCACGGCATTTCGCTGCTTCTCATCTGCCTG
GGCTGCGAGCGAGTCGATGACATCACTGTACACCACAAACACATCGTCACCTTAGAAAACTAAAAAGTAAAAAAAAAAACAGATTGGCAAACGTACTCGT
AGACGTTGAGCGCGATAACGTCGTGGTTGTCAGCCAGGCCACCAGTAGAGGCCGAGATGCCAACGTACGCGTCGTTCATCCAGTCGTCGCCGATGGTCAG
ACGCTGGCTGTAGCACTTGACCCAGTTGCCCGAGGCATCGGCGTCAATAAGGATCGTGAACTGCTGGTCCGCCTGCGTGTACGTCAGCTTGGCGCGCGAC
ATGTTGAGCGACGGGCTGAAGGCCGCGTTCTTCTCGTGGTAGCGAATGCCCGGAGCCATGCAGCCGACCTTGTCCATGTCGTTGAGGTGGTCGAGCGTCT
TGGTGCCGTCGTTCTCAAAGAACGTCACGTCCTGGTGACCGCCGCTGTGCTCCTGGTTTACGAACGTGTCGAACACGACGCCGACGCCCTTGAACTCTCC
AATGAAGCCGTGGTTGTCGCCCTGCACATACTGGCTGGTCGTGAGCCAGAGCGCCAGACCGTCGCCGAACCAGGTCTTGGCCTGGCCGCTGATGCGGAAC
GTGAACACGGCGGCGAACTCCTTGGCCGCCAGCTTCTGCTTGCCCCAGATGTGGCCGCGCTTGCTCTGGCGGTCGGGCGTCAGACGCGCGAAGTGGCGGT
TCACGGCCGTGTCGCCGCCGTACACGAAGTTGTCGCTGATCTGGCGCAGACCCTCGCCGTCGATGTTGTCGAACGGCTTCTCGAAGGAAACCTGCTCCAG
CCGCTTGGCGCTGGCGGGTGAGGACTGCAGCGCGGCGAGGAGCGTCGCCACGCACAACAGCAGGCCAAGGCTCACGCGGGAGGCGCTCATGGTAGATACA
CGAGGAGGCAGGAGCGGAA