Description :
From Genome Similarity Track
Location :
scaffold_29:5735- 10020
Transcript NameFunction/comments
Plaha_PHALS_05094hypothetical protein

Sequence
4285 bases(100 bases per row)
TCCTTGGAACTGGTCAGTACACAATGGCCTTAATCTTAGCGGGAtcagctcgaaggccacgcttgccgataaagcaccctaaagaaGGGAGTTTTTCGGC
GCCAAAgatacacttgtctgcattagcatacaacatatttgtgcgcatgcactcgattaCCActtttaaatggacgatgtgatactcttcatccgtcctc
ccgtgccccgcacgattgtggacgaagatgttatCGAAGTATATCTGCGTATATGCCCGAAAGGgcctaaacaattgcgtcacaaaccGATtttatgttg
ctggtgcatagACAGCTCTTGGGGCatcgccagccactcccagagcatcccgctcggagtattATATCCCTGTCAGCGGATCAcatgctctcatgagcaa
ttggtaacaacCATTGACCAAgccgagtgcgctgtactttgtacagcgagccatattgttctggagaacatcgtTTCTaagaatcggcgtttgtgtcgga
atggtggcagcgtttattTTATTGTGTGCGTGTAGGATACGCCActaccgttcggcttccggacacaaaaggtgggagacttgctctcacgtaccattcc
tgccaAAGGCGTCAAAGAGGTCGGacagctccttgggcaggggccattggcgagTTACACAGGATTTGGTTCCCGAGCTAGGTCAATCTCACGACGCACA
AagctcggtccggaggtagaatCGTACAGctggtctttggagacgacgtcttgacatTCATTTACCAAAGAATTAATGGGATCCGAAGAATTCTTCAGGA
TTGATGACCCACTCTGTGCGTTTAGCACCTttttagtgtcctccaggacatcttcatccagaagcgatgacaaaTTAATCTCCTCATTCGGTATAACAAT
GATCACCTCGGCTGATTTGATTGCCTACAAGGCATTGCTAAGCTCTTCGGagggcatctcgtccagtTCAAGCCGAACATCCACCGCGAGAACaacctcg
agggtgacgtcaccgtcttcctctcccgacATACTGATAACGacggtatatagctgtgcgctatcgtcaacGCTAGACACACCTttagtcagggtcgacg
gaTTGCGTCTTGTAGATACGACTTCGTAGTCCTATCTCTGTAGAGGGAGTAtgtctcgtcgagaccaATGGGAAAACACACTTcgcatcgtccagtgtcc
tcactccctgctccatccgAAAcatgatgttatctacaacatccgacgaagggtTtcaatttccgcagtcttcgtccagtggataatgtgccactccacc
cGTATCattggggcctcgcccttaatgcctcggacctcgtccgactatgccattcttggcatgcagcaaatgctttgtaacgtgaacagtgctcagtgga
tttcgtgccaatccacgtgtatcacaagggcctttcccttgatgcctcgggcccttggccgaccatgccccTCTTGAAACACAGCGACTgttccgatact
tgagcagtgctcagtaggTTACGTATCatttcacgttcagcccgcgagcccgGCTCTAGACTCTTGTCGAAAACACatttggtgttcgacaactcggata
ctctgatatccagcacattgaccgtcctggtccagtgcccgcaccaatagcgcttctactTCCTAGCAGCGGTGGGTTCATGGCTCACCAGAGCTCCACT
AGGAGATGTGCGCGTGGCGACCAATGTCCTCACCTCCAAtaaatccatggctcatggtgcccCAACCATGACATACCAAGAATTAGGTCATATCTTGCAT
TCAATTCCAAGACTGGACAGCGATCCGCGCAATCAAAGTCATGGaagttgacaccgaggtccacagggaccctctgCGCAGTGGCACAAATTCCCCTCGC
tatgcgaacagtgacggcgtCACTCAGCCGCGCATCCAGCTCCTCCACATACAGCTGAttttcttcgatcgtggagcgtcgcgcatatttgcccgacgcc
ccggaatcgataaatATTTTCCATGGCATCATAAACCTTTCAAGGCTGCTTTTGCGACCAGCAAGCTtagcttgcacacacgttctgtgttcaggagcac
gaagctcttcggtctgggccctgctgtcctctacctctttgaggcgcAACAGAACACAGTTCACCCCCCGTAGGTTGCCCCGCGCCTTTTGGATTTGTTC
GTTTCCTCGCGTCAAACTAGACAGGTTAGAAGGGGGACGTCGgctcgacgaacctttacgcgccgtGTGCAGGGGAAAacccgtccgaaggtgacaggtg
tctccacagacaaaacacctaAGCAGCTCGGAACTTATCCTCTTCtttctcctctttctcagcatagctgacatCAATTGACcaaggcccgctcgacgag
atcGGAGTgcgtgcattccaaccaagtcgtgtcgatTTAAAGTTgcattcggcattcaataccacgttcactgcttctttaaaaaaagacgaatgcagac
ggaagacttccattctggccacgccagtgcggtgaAAAACGCAGCTTGAACCGAAGCGCCGCACGTTAGTACCCAGTCTCGTGCTCGGtccccgagcttg
aagatagctagcaccacgagctattgctcgttttggagcatagcagatgccatagccatctcggtctcTCACAGCCAGAGCAGGAGAATTTCTCCTTCCT
CATTCTTGAAGGTCCTAACGATTAACATGAGCGCCTGGGTCgaaaaaatcatccgtcgttgacggtgacgtcatagacgcagtcgaaACTGAGAGCTTCT
GTTGTATGTGCTCTaaaagagcatttttataactTGAAACAACTcaaggcgcgcgcttatggcctcgggTCCTTGCGCAGCGAGTTGCTACACGTCCTCA
cggcccagcagggacatcagcttattaagcccgtcctgcatacccCGGGGCGAACAAGAacattcctccatcctcacaaaggatcagtcgtaacgacgca
ggcgtaaattgactacgagtgctaccaagtgcagcgaggctcgtagctttttgctgagAGAATGCTAAgcaaagtcaccgaccttacgttctttccaagt
cTCagtcgagtgtagcggattgcgatccgctacctccacgTACTAAAAATCTAaatcaaggcaaacgaacattcCTGTTTAAAAGTGAAACtgaatttaa
ttgtttaattgcggtagagccgccaaCATATAAAACctttgatttttcttttgatCAACACCTAATTGATATTGCAAAATCTTATtagtatagtaatatg
cattactactggcagtcctgccacgtggtggcttcttgttacagtgtagccacaacactgtgtgattacactaacttgtataatacacacctatgtacga
tcgcacaatcttgtgcaaccCGCCCTattatacaagggtacgggtaaccctgttacacatATGGCTTGACAAAATGACACGGCCATTGCGGCTGACGCCA
TGCAAATAATTCACGGTAGGTGTTGTGCGATAAATAGGACACAATGACTCTTCGAGGCCCTACACATACCTGCGCTCTTAGCAAAACTCAAACGCTTAAG
CTGTTCTGTCTGAAGGAATCTCTTCGAGCATCAGACGTATATGATCCTCCGCCTCGTCTCTGGCTAAGTTGCGCATCCGTTCCCTTTTTCTAATGCTGAG
ACCATGACGAAATCCCGCCGTGGAACATATAACGAAGTTCGTCTCGCTCTTAATTTATTGGACCTGGCTCGGCAGCAGGGTTTGCTCGCCTATTAGCGCA
CGTGTCGTGGCTACTTTCGATTCAGTAACATCAGACCTGACCACCCTAAACGACATCGGGGCCATGAATTTGTCTGAAATGTTTGCTGCGTCGTGGCGGA
GTTTCAAGTCACCTACCTCTGTGGGTCTTTACCCCAATCGGAGAGTAAACATGCGCTTGATGATTGTTTTGAGATCACTTCCTAACTCCTTCTTGAACTC
ATTGATTCCCACGTCTCATAGAGCACTTCCCGAATCCTTCCAATCTACATGACTTACACTGAAAGAGGACTGCAACTATGGTACTTGGATTTGgcaaaaa
aatgcaaaataGTAAGTGACTCGATCACAACAATGCGTGAGAAGAGATCATCGTATAACTTGTTACTTAGTCCTAAACCGAATACAGTCGAACAGAAATC
GGATAAGACGGTCACTTAATGTTTGAGTTTAGAGTATAAAACGCGACGTTCTAGTCAAGACAGTAGTCTCAGCCTCCTCAGGTTC