Description :
From Genome Similarity Track
Location :
Scaffold_515:5735- 7959
Transcript NameFunction/comments
Phymu_g10503urease accessory protein, putative

Sequence
2224 bases(100 bases per row)
CCaaaaagagagagagagagcgaAACGAAGTGAATTGACTGAGTGTTCGGGTAATTGTTCTCATAAACAATTCAGTTCATTTAAAAAGGTAATGAAAACA
CCCCTGGTCACGTTGGGGCGGCACTTGGTGGAGGGAACGGCGTCGTTCTCAAATGCTGCCTCGCTGGATTGGTCTCATCGAATCGGTCGCTGCGGGGACG
TTCCTCTCCAACTTTACAACGGATGGTGACTACGAGTCGTATATTTCCGGGGGGATGGCGACGTGGAGCCTCCAACAGTAGAAGAGTCTTACTGTTGAAA
ACAACGGAAACGTTGGCACTACGTACAGAAGGCGAGACTAGAAATTAACGTGCAAGCTCACAGCTacggtacagtacatgcatgCAATAGCCTAACGAAT
CGTTATAGACATATTCCAGCTTGCAACTACAgctatacatgtataccggtatcttCGTATGTTCACCAGCACATGTAGAACATACACGGTACACTGGTAT
ACAGAGGCCGTCGTTCAGTGATTGGCTGTTGCTATTGAAGTTGCAAGGAGTGACATCTatgagtgatggtcaatAATAAGATGTAGCCATATCGATCGTC
GATTCAACCCACTCTCTCTGGCTCCGTTACCAAAAAGATTTTCTTGTGGCGCGGCAAGAGGAAGCGTCGGGCTCGCTGGGCGACCAGTGACCAGTGCTGA
AGCTCAGTTTGCAATCTCCCGACCAGCGCTCAAGATTCCAGCACCAACAtggccacagccacgtgCCAAATCTGCCTGGACAGTGTCGAGCCTCCTCACC
TGTGCACAAAAGTGTGTGGCAAGAGCTGCGGCGCCGAAATCTGTCCACAATGTCTCGGCCGTCACGTCGAGGTgacactgcagcagttctACCCTGGCGT
TCTGCCCCGCATTCGCTGCCCGGTCTGTCTCGTCGCCATGCACCAGAGCCGCTGGGAAGGTCACGTCCCTACTGAAATCAGGATGGCATTGACGACTAAA
TACACCGAATTGTGTCGCCAAGCGTGCGTGGTGACACCTCCGTGCTGCCATAAAGCAGACTACACGCACCTCACAGCGTTTGACCCGCACCGCGGACCTT
CGAGCCCGATCTTGACTCTACCGTCTCAGCTTGATAACTTCAAGGCGTTGTGCAAGAAGTTCTGCCGCCACAAGATCGAGCCTCGAGTAGTACTGGACTA
CGCTTATGGCACTTTTGGggaggagaaggctgcggctATGATGAATGAATTGGCTCTACCGCGCATTGAGGACCCGGAGCGACGTGCcacactgctgctg
tcgctgatGTACTTCCGACCGAACACCAAAACGAATTGCTGTGGTCACGatttctgcttcaactgcaaaCGTCGGGATCACCACGAGTCTTGTCCGGAAG
ATTTCAGTGAGAGCAACGACCTCGTGCGCTGTCGTTCGTGTCGTGCACTGCTGCTAAAGGTTGAAGGTTGTGACGCCGTCAATTGTGTCTGCGGGTTCAA
CATGAATTGGTCGCAGGAGAGAAAGTTCCGCCAAGACCGGAAGAAAGGGATTGTGCCAGTGGATATCTTTGACATCCCTCTTATGGCAGATTGGGTCGCG
TTTCGACCCAGACTGGACAATCTGATGAGGAGGATGAGAGCGAAGTGGCTGCACAAGCAAACGCTGGCAATGCGTCCTCTTGTGCATCCAACTTTCGCTG
TCTACATGTGGCGCTTCCGACTCCGCAAGGTGCTTAAAACGCAATTGTCTGCCGCATGGATATCAAGACGTGCTAAGCACGTTGACGAGAACATAGTGGT
GGTTCGGAGCATGATACGGCCTGCTTTGGGATCGTATATCTGGCGCTGGCGATTCAGCAAGGCTTTGACTGTAATGAAGACTGAGATGTACTGGAAGGCA
TACAACCGTTGGcatccagaagaagtcgaggctgaagctgaagaattGAGCATTTTGTTTAGCATCGGGTCATttgatgacgacgagtaACTACATTTAC
AGCATACTTATTGTTTCTACATTTAAAGCATAATCTACTTGAAGTATTGTTTTTCAAACGAATTGCAACTTTATCTTTGCATAAAAAACACAGTAGCAGT
TCATCCTATCCGGTCTGTTTGGGTTTCGTCTGTTGTGTACGGTTTGAGTATTGAACACCTACGGTAGTGACCACAGAACCACTTCGTCGTAACATGCTTA
ACGTCGGCAACGAGCAGCACTCAC