Description :
From Genome Similarity Track
Location :
Scaffold_119:5731- 7619
Sequence
1888 bases(100 bases per row)
TCCAACACGTCGTTGCGGTACGTCAGCATTTTCTCGTCCAGTGTGAAGCCTGTCTCGAGAAACAGCTTCAAGAAAACAGCGAGCAGCTTCGAGTCCGACT
TCTTCTGCTTCTCTTCGTGGGCGCTCCATAAGCGCCGGGTACGCGCGTACCACTCGAACCACACTGAGTGAAGATGATTTAACGACGACTGCTTTCTGGG
CTTTGTATATTTGCTGACGTTTTCATCCTCCTATCTGCGCTTGTTTTTGTATTAAGGTCCTCAATTCGTCGAGCTTAGCTTTGAGCGCATTCATGCGCTC
GTCTTGGCGTTTTGCATTCTGGATAAATTGTTCAATCACAGAAGCTTAGTGGCGGATGATTTTGCGTTCTCAGACTCTGTGCTTGGCTTGTTTGGTGACT
TTCTTCTTCTTCTTCTTCTTTTTCTTCTTCTTCTTTATGTACCTCTGTACAGGTAGCCGTGGCGAGATGCATGGACCACGCAAGCAAATCGGCAAGGGTG
CTACCAGACTCCAGTACGCAAGTTTCCAAGCGCTTTACAGCTGATCCGTTGGGGTTTGCCTCTTTAAGTAGCGGGAAATGCAGAATCAGGTACGCCGTTA
GCACGTCGATGACGCGCTGACTGACGTTGTACTTCTTTGCGTTGAGGCTCTGACAGGTCGCGAAGAGCAGCGCCTGTACCTCACGTATACTGTCCTGCGT
CCGAGCGTCGAAGAGCATTAAGTCGGCGAGCAATACGGATTTGTTCGGCTTCCGGACGCTCAACACCTTCGCAACCTTGTGGTCCTCGTTCATGGTGTTG
AATACGTAATCAAACGCTTTGTTTGTCGTGCTCACGTTCTAGGCGGCGCGGTTGGAAATCCAACGCGCCGCAAGTTGCGCGCAGCTGTTTGCGTGCTGCG
CACCGCTACGATGGAATGAGTGTGACGTGAGCTGCTGCTCCACTCGAGCTAGGGTGGCGACACGGTCGAGGAGGCGATTAACGTGGCTGTGGAGTGTCGG
TGAGATGTCTTTACCTGAGGCAGCAGCATATTGGAGGCCGCAGGAAGCCTTCGGGTGGTCGAGAACGTCAAGAAGCGGCGTCTCAGGGCCGAATCTGACT
GTGGTGTTCACTAGTTGAATAGGTAAATTGTAAAGGAGGTCGGCACACGACGCTTCCCGTGTGATAGGTGCCAGAACGACGGCGTGCAGCGGGCACGGGG
CAAATCGTCGGTGGGGAAGATGGAGAGTCCCTGCTCTTTGCACGTTTTCATACGAATGAAGCGTACGAAGAACACGTCGCTCGCATCGATCGAGACGTTC
TGTTTGCAGACGAGCGTCAAGTCGGAAGCACACCCAAATAGGACCAAAGAAGGCACAGCAAAGCAGCATCCTAGTAGTCACTAGACGAACATGCATTTAA
ATACAAATAATACATCATCTGCCTCCAGTCAGTCTTCGTACACGCATTGGCCTTCTTTACAAACGCGTCACCTTCTCTCTTGACAGAGTAGTTCTCTAGT
GTTTTTCCCATTTCGAGTAGCCGTGAGTCTAGTATAGCACGCTGCTGCGGAAACTGATCTAGCAACCAATGCTTAGTTCGTCGGTAGCATTGGATGCAAG
AATGTCTAGCAAGCGTCTTGCCAGCTCTGCCTTCGTGAAATGCAAGATGCATACCGAACTAATTCATTACAGACACAAAGCACTGCCCAGATTCGTCCCG
CTGAATGCAGCCCTTGACATACTCTAGATTTGCATTCTTAGACTGTAGAGACCGCAATAATATCTTCACAGCAGTTGCTCTGGATCGCTTGGACTTTCCA
GGCTGCAGATTGGCTAAACTCATCTAAAGTCCGACAGCACGCAAATATGCAAATGATACACCCTTGACTTGGGGTTTGTATGGACATA