Description :
From Genome Similarity Track
Location :
Scaffold_444:573- 6759
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_444-snap-gene-0.11Phosphatidylinositol kinase (PIK-L4)

Sequence
6186 bases(100 bases per row)
TGTAAGCACGAAGCAACCACCACGAGACATAACTACCTAGACTACTAGGCTAAAGGAAAGGCATCCAACCGATGTACATCTGCGCGAGGTTCTCGAGAGC
GGTCGCTTCGTGAATCAGCTTGTCCACCTGGCCTTCAACCGACAACGGGAGGGTCTCGTTCTCTGGCAGGATACGGAGGTGCGAGGCCGATAGATGCGGT
CGGATCGCCGCGCCAAGGTTGTACACGCCGCGCAGGCGATCGTCGATGGCTGCAAGGATGGCGTGCGCCTCCGCGTTGCCCTGCTCCCCGTTTGAGTTGC
CGTTCCCGATATCACTCCCAGCGCGGTCGCTGTCGGCCGAGCTTCGCTGCGTCGACTTGCCGCGGCGACCCCACTCGACGAGTGGGTCGTGAATGAACGA
CTCGAGCACACTGCGCAGAGTCGCCTGGTTGCCGCGCAGCAGCTGCATCGTGACCTCGCCGACTCGCCGGAACACGCCCTCGTAGCCGGTGATGCCGAAA
GCGTCAATCATGTTGGGCGTGAGTCGGAACGGCACGATCTCGGGCTTGGCAAGCTTGAGTCCCTTGTCGAACAGGCAGTCAAAGTCCACGTGCACGCACT
CGCCGTTGGTCGTATCGATCAGGATGTTCTCGCCGTGGCGGTCGCCCAGTCCGATCACGTGGCCAACCATAGACCAGACAGCCGCCGAGCGCGCAAATGT
CAACCGCGCCTCGAACCACGCGGTCGGGTCCGCAAAGTTGTTGTAAAACCATTGGTGGAACCGCGGCGAGAACTCCGGTAGAGTCAGGATCTTGCGGCGA
TAGTACGCAGCCATGGTCGACGGGTTGTTGGCATACTTTTGCTGCATGTACAAGTACCGCTCCTTGACGGTCGAGAGTCGCATGGGCTGCACGAACCCGC
ACTCCGTCTTGCGGATCTGCATGATGAGTTGTCGCATGGCCCGCGTGTTCTCGACCCACTCGATCAGCCCGCTTTCTTCGTTCAAGCAGACAACCGCGTA
CGTTCGCAGCCGCAGCTTGCGCTTGCGTCCCTCGTCATCTTTCTGCAGCAGCTTGTTGACAAGAACGTTGAACTCCATCATGCGCGCGTCCTTGCGAAGG
TCGCCAGTTTTCTCCCGCTTGCACAGGAAGGGATACTTGCGTCCGTCGTCGCCCAAGATCTCGATGCGCTTCGGCTTCTCCTTCGTCATCATCACCTCCG
CCTTGTCGGTGAACGCACTGATGTGAACTTGTGTCGTCAGCGCGAATGCCGTGTGCTCCTTGTCCGACGGCGCCTTGCCGGATACCGGCAACAAAGTCGT
TAGCGCAGCTTGAATGGGCACCAGGATCTTGGTTCGGATGCGGCTTAGCCGAATGTGAATCTTCTTTTGGTTCTGAGGGTCGTGGCTTGCCAGCATAATC
AGCTCGTCGACCAGGAGGCCACCTTCCTCAAAGCTGGTGGCAATGTCTTGACGCTGTGCCTTCGCGAACGCCCGCTCTGTCTCGGCAATAATATGCTTGG
CTTCGTATCGGCGCTTCGAGTTGAGTGACCGTGACAATCCAAGAACAGGCCACATTGCTTGCGTCGGGTAAGCTCTCAACACGTTGATCATGATCTGCCG
AACTCCAGAGACAACCACCGAATTCGGGTGGCACACGCGCGACGCGACCTGCGGAAAGCACATGAGCCACTCGTAGGCAGGCAATGTGCGACCGGCTTCG
TTCACAATCGCATTCATATCAGCGAGCACCTGCTGCTCCAACTTCGCCTGCGCAGTCTCGCGCTCGAGTTGGTGCGTCGTCTTCCTGGACTTCTCGCTTA
CTGACCACACTGAGGCGCGTGTGTACAGCAACTCGCCATAATCGAACCAAAGCGTCAGAAGCCGCGGCAACGACTGGAAGACGAACTTGGTGCCATGACG
AAGAGCCAGAACGTAGTTCTTCATCAGGTGGACCAAATAGGTGTGGATCTCACTGTCGACCACCGTCTGGGGACCAACCTCTTCTTTCTCGATCGATCCA
CCTCCGGTATTGGTCGACGAACCCTCCGGTCGCCTAACGCTGAGCAAGTAGTCGTAGTATTTGGCAAGGAAGAAGTAGCCTTTCTCCCACTGGGGGTCGA
ACTTGATCACTGCCTCGTATCGTTCAATGACTTTCTTCCCCTGTCGTTGTCCGCTTTCTTGCATCCAGTACGTAGCGAGCAAGAGCGTTTTCGCACAGTG
GTGGGGATCCTCAACGCTGAAATCGAGCTTCGTCGGGTCGATATCGACAGGTTCGAGCACCTGAAGCGCTTCATGCATCCGGTCTTGGCTGACGAGCAGC
TTTGCTCGCTCCAACAGGGCATACTGAGTCCCAAGCGCTTCGGCATGCATCACGGCACTGTTTGACGTGCGTAAATAGCCTTCCTTTCGGGTAAGCTTGG
CGTACTGAAGCCAGTTGTGCGATACGCTGTTCTTCATGTCCGCTTCCTGCAAAATCACTCGGCGAAGCGCCAGAATTGGATCGCGGTACTTGAGCGAGGG
TGACAGCATGTCGTAGCGCATATCCCAGACAGCGTGTTTTTTCCACAACACGCCTCGCTGCTCCAAATCGAGCTCTTCTTTGCTCAACTGCAAAAATATG
AACCCCTGCTCAGCCTCATGAAGAAAATGGAGCTTGTGCAGCAGCGGATACGCTCGTTGGTACGATTCAGCCGATGCTGCGGCCAGAGGACCCATGATTT
CCAATCGGGCTTCGTTCAGGCTGCGCGTAAACGCCTCCGTGTCGCGCGCGTGCAAGCTGTGGAGCACCCGAACCAGCAACAACTGTGAGATGTCTACTCG
ACGCAATCGCAGATCGCCACCATGACCGCCGCCAGTCCCATTTTCCACCGCCATCGATGAAGACAGTAGCGGGTTCTGCCGCTCTGCACTCAATAGCTCC
GTCACCAGATCCCAACGCGAAAGGCGCCACGAGCACTCAAGTGCGTACGGATAAACCGTCCCCTTGAATTGCGGTTCTTGCGTCGCGATACCGTATATAT
GTTGGAGCGCGCTCTCCAGCCGTCCCAACTGGATTAGGCAGCCAATCATTCCCGAATAGAGTTCAGGCTTCATCAGCGCTGGATTCCGATGAGCGTCAGC
ATCCAAGTGGAGGTCGTGTTGGCCGTGGACGTGGTTCCCGTATGGGAGATCGCACAATGATCCCGGTGGGAATGCCGTCTGGATTTCTTGAATGGCTTGC
TCGTAACACGCGAGAGCGTCCTCCCACTGCGCCAGTTGTTCATGATCAACAATCTGGTGCATCAAGTCCGTCAGATTCAATCTATCCTCGTTATCGGCTT
CTCGCTGCGCTTGTGCAACATCGCTGTGGCTATAAGCATCGTAAATGCGCCGTAGTGTTGCGAACCCAATGAGAGCGTCAGGTTCGTCCACGCTTTTGTA
GAGCTGTTGAAGGTACATTGCGTTCTTGGCTATCAGTCCAAGGGGTACTGGACCAATTGCACCATAGAAGGTAGTTCCGATCGGACCCGACGAAGAACCC
TTTTGCTGCCGCAGAAACACTTCAAAATACTGGATCGCCCGCGCGTACGCCTTGATTCGATAGGCGGCATTTGATAACACTTGGCTCGGAATGTCTTTCA
AGAATTCGTCCAGGTTGTCCTTCTCCTGGTCCTCAAAGTCTGGAGGAGCTATATCCGCAGCACGGCTGCCTGCTGACCCTGCAAACCGACTCGAGCTGCT
GCTGGACGGGATACGCTTCTTCTCGCTTGTCCACACCCAGTCGTTCAGCTCATCGATGGTCGAGAAAATGGTTTGACAGCACTGGTGGTGACGACTCGAT
GTGTCGCCAAAGGTTCGGTCGATGGGAACTCGTCCGACCGCACTATCCTCGTGCGAACCAGTGTTCGAATCTCCTATGTGGTCTGCCTCGTCTTGCAGCA
TCATGACTTCATCTAGGACGATTCCTTCATCCCGGTCGTTCAGGATCGTCATCACCTCACGCTTGATTTCTCGGTATACATCGGGTCGACCAGATCGCAG
GACATTCTGAATCAAGTATGGCAACAGAAAACGTGCGATCTGCGGACACGTTGGGAGGACCGATCGACACGCAAGAAAGATCTTTCGTTCCGGTGGTTGG
GAGATCTGAATCAGCCGTCGACACCATGTCTGCAGCCACTCTTCGTACGAAGATCCGAACTTTTCGTAGTACGTAATGCCATCGAGGGCCGGATGCAGTG
ACCGATCACCGCCTCCCGCATTGCGATTGCTGTGTCGACTGCTTGACACTGTGTACTGGGTCGCCCAGTATGGCTCCACGAACTGGAAAACATCTTTCCG
CTCGAACCTCCTTCTCATCCACTCTGGCATCGAAGTACTGGACGAACCAGACGCATTCGTGTCTGGTCCTGTCGTCGCTGGAAGAAGCATTGTCGAGTCC
AGTCCACCCATGGACGCCAAGCTCTGGCCACTATGCTGTGGGTCGGCTGTGAGCTCCGCAAGAAACTTGAGCAGTTCTTGAATCGCAAAGGCAACGAAAT
CTGTGTTTTCTGGAGCCGCTCGAAGCTCCTTGACCAGCCACGACTCGATCAACACACAAGCCAAGTCCTTCGTAGAATGCTCCATCCGTCGATACAGCGC
GTCCTTGTGATTCCCGCGTCCACCAGGCGACATAAATATACTTAGTGGCATCCGAGCGGCGTCGATGGCGCCAAGCGCACCGAGGCAGCGAGCACACAGC
AGTTTGATGCTTTCGCTGCTCTCTGTCCTCGTCACTTCCATGACAGACAATACAACTGCGCTGATTGCCGAATCAATAAATAAGTCTCCTTCGCTCTGCA
TCAGTCGCTGCAGCTCCGAGCCGCGACCAACCAAACACCGAAACAGTTGCGCCAGTGCGACCTCCCGCACTGCCACATCCCAGTGATTGACATACAACGA
CACATCTCGGAGATACTGGTGAAGTGCTCGTTCTGCAGGATCGCCGATTTGGCCAACGATCGAGGCGTAAATCTCGTCCAGCTCCGGTGTCGAGGGAAGC
ATCATGATCTTCGGAAACGCCTCTTTCAAAACGTCGCGCTTCTCAATGAATAAGTACCTCAGAAGTGAGATCGCTGTATTCATCGTAGCTGTGTTCGACG
CGGTACGCCCATCCAAGGAAGCTGTCGACCTGATGAGCGACTCGACGTTCCAACACACGCTCATCCTTCCTTCGCGAGCCTCGGCCAATATTGATGAGGC
GTCGCATTCGAGGCACGGCAGCAAGCTGACCACAATCGAGCACAAGTTCTTTTCCAATGCCTTCGGTGATAGCATGCGCAAAAACGTGCTCCAAGCACGA
ATGCCATGCTCGCGCAACTCTGGCTCGATCAGACCGATCTTAAGCGTGGCCATGATCTTCGGGACGAACGCATCCACAGCCCCAGTTGTGCTTTCAGTAT
CGGACGGCGCTGAGTGAAAGAGATCCAGCAATCGATCGATGCTCTTGATTGCCTGAATCTTCGTCGATGTCGACGAAGAGAGATTGCCCTTACTACTGAT
TCGACTTCCCAGGTCTGTCATGAGCGCCAAAAAGTGTTGGGGTTTCAGCAAAATCCCGACAGACTCCATCTTGGCGTCATCTTCACCTATCGCACGACCG
GCATGCAAAAACTGTGCGACCGTTCGGAAGGCTCGCTTGGCCGTCTGGTAGCGTGAACCTCCGAGTTCCCACGCCAACAGATTCTGCAGCCGCACAGGCG
AGCGTGACATCAAATCGTGCACCGTGGTGTTTTCCGGCATGAACTTGTACAAGAAATCCCACCCGGCCATCCTGTTATCATTGTAGTTGGTCTGGACTTG
GTGCATCAAAAGCTCTTTCAGCACATGCTCAAGATGGTCGAGCAGCAGGCCATCGATATTAATCGCCTCAAAGCGATTATCTTCGGATTCGTCTTCAAAC
TTTCCTGCTTGCTCGCCATTCTCATTGTATTCGGTCACAAACTGACGCAGCATCGCTTCATTCTTGTCAATAACGTACTTCGGAAGAACGTGCGGTGCGC
TCGCAAGTAAAAACCTCCCCACATCGACATGCGACCGCATAAACGTCTGCACGAACAGCTTCACTGAGACTGAACCAAGGAGTTCGTCGACAAGAGGGAA
GTAGCACAGGGCTGGAAACTCGATGCACAGTCTTCTCCAAGACACGTTCTGGTAAACCATGACGCGGTGGATCTGATCGAACGCGG