Description :
From Genome Similarity Track
Location :
scaffold_1818:573- 1977
Transcript NameFunction/comments
g11710.t1hypothetical protein

Sequence
1404 bases(100 bases per row)
GACGGATATCCCTATCGCGATTAATTGCCTCGGAAAACCCATGCCACCAAGCCTACCAACGTTAAATATATCCTTGCAACGTCGCAGTGCATCCTCTCTC
AGGTGTTGAGTAATGGCGACACCATCCTCTCGAGTTGGGGTAGACTCAAGGCCTTCCTGATCGCCAACTTCACAGATGCAGTGAATGAGCTTAATGTGAC
CGATATTTCCTCGCTCAAGTCCGGAATGAAGTCCAATTCAACGTGTGGTGCTGATTTAAAGTCACTACTGGATCGCACGTGGATGACGATATCTCAGTAC
ATCCTGACATTAGCGACGCTGCAGTCCGCCTGAAGATCAGTAACTCTAATCTCGTACTGAACGACATCCCCACGGTAACCAACAACTGCATGGCTCAAAT
GATAGCGGAATCGACCGACTCGACGGCCTACGAGACGCGTGAAACACTGCGGAAGACCTTCGGAGTCGTCATTAACGACCTCATAGCGAAAGGCACCAGC
AACAACGGCACCACGTTGAAGGCGAATTACTACGCGTATCGAGCGATTCAAAAGGGGATGACGGTTCTGTCTGCAAGTGGTTGGGATACGATGGATATCT
CGACGTTGTTGGTTGCGTACATCCAAACCATTTGCGGACCCACACAGTTCATGGGTGAGATTGATGATGGCGACGAAGATGTTACGCTGGGTCTGCATTC
GATTCAGAAGACGTCTCCAGCTCGTGGAAAGAGTGGGGGACGGCCAAGTTGTTGTTAAGTTTACGAGTAAAGACACACAGGCGGTGAAAGGGAACATCAA
ATCTGGAGGTGACATGATCGACGAGGTGCATATTCCAGCGGGGACGTGGAAGTCGACTACAAAAGTGTTAGGCGGCAAGACACTTTACCTAGACCGCTGG
CGTCTTGGATTCCTAGGTCTTCCTGGAACAGGCGGGGGATCGTTGGTGTTGTGGGGGCCGAGAGCGTCCCAAGGCGGTCATTTAGAACTGAATGCGCGAA
TAAATGTAAGCTTATTTATAAACTTGTAAGTGAACGAACCCACAGATGAAGATATTAAGGCAAATAACGCAAGGGAGGGACTTTCACCGCCATTGTACAT
GTGTACTGTATCTGGGAAGTGCTGCACTGCTACATGACAGAGTCAGTCAGACAGACATTGTACATGTAGGTAGGTAAAAGTTGATTAACTTTAGCTGGAC
TTACGTCTTGCAGACCTATGCTATTACCAGTGTCTTACGTCTAGCATCGCGGAGTCCATATTCGTTGTCGTGGGAGGTTAGGAAGAAGTTCAGTCTGTTC
TGACACGAATCCCAAGCGCGTAAGCACTCGATTAAGCGCTCCGCCGTCAATATTCCAATCAGATGAATGCCGAAACAGGAAATGGCAGTGGCTTCGAAAT
GAAG