Description :
From Genome Similarity Track
Location :
scaffold_83:57296- 59129
Transcript NameFunction/comments
Pl_110191conserved hypothetical protein
Pl_110192hypothetical protein PHYSODRAFT_469633

Sequence
1833 bases(100 bases per row)
CTTCTCCATCCAAGAAACTCCGTGTCTTATGTCTCCATGGTTTCCGTACGAATCGTCAAGTGATGGAGAGTCAGACACGAGGTCTTCGTGACGCTTTAGG
GCCCAATGCTGAGTTTGTCTTCCTTAACGGACCATTTGAAGCTCGCGGACCAACAGATGAAGTGATCGAACGCATGTTTGGCGAGACTGCACCGTTCTAT
GAGTGGTGGGGCGCTCGGTCCCTTGAGAAGGAAGAACGAGACGACATTGAGGCAGAGGAGGGTGTTCCCAGAGGCACCACCAAGCGCTGGTGTCTCGAGT
TCGACGACATCGACCAGGCCATTGAGTACATGGACGAGAAACTCAATGGCTTGGGTGAGTTTGATCTGGCTGTTGGTTTCTCGCAGGGCTCCATCATGCT
GACTATCTTGTCTATGTGGTACCTCAAGAAAACCAACAAATGCTGGTGGAAGCTCGTGCTCTGTGTCTGCGGTGTATATCCACGAGGTATCAATGTTCGA
GAGCTGTTTGAGACGCACGAGGGAGAGCAGATACTAGTTCCAGTCCCGTCGATCCATGTTGTGGGACAAAAAGATAGTTTATATAAAGACTCGCTGGTGC
TCAAGGATATGTACGCGCCACACGTCAAGGGCAGTCCACTACCGAGATTGTTGCTAGAGCATGATGGAGGACACAAATTCCCAACTCCTAAACGCCACCA
GAAGTTTTACGCAGACCTAGCTAGCACAATTTGGCAGTTCTTCGAAGACACACGCCAGAGTACCGTGGCAAGGCTTTGAACAGATTAAGTGTTGATAGAT
GACAACAAACCACCAAAATACAGTCAACGTACCAGCTTCTTGTTAAAGCTGCTTCAGCTTTTCAAGGGTGACGCAGCGTTATCCCATCGATTTGTGTACG
TCATCTTGCTTGAAGTTGGTCTTGATCTCTGTTCAGTCGACATTTTGCAGCGCTTCCAACACTTGCAGTCATGGTGATCGTCGCTGAGAATCTGCCCCAT
CCTACGGCGCTAACTCCTCGTTCATTTACCGCCAACAAGAAGATCCGCGTGCTATGCTTGCACGGGTTTCGAACTAACAAGCAGGTCATGATAGACCAAA
CTCGCGGCATTCGCGAATCACTGGGAGATTCAGCTGAATTTGTCATACTGAACGGGACGTACGAAGCCCGCGGAACGAGTGACCCGATGATTGAGAATGC
GTACAAGTCTAGTGCTCCGTTCTACGAATGGTTCGAGAACCAATTGGCCGACGGATCTCCGCTGTTGTACAACGATGCCGAGTCTTCAGCCAAAGCGCGT
CTTCAAAGTGGTGCAGACAAAGGAGAAGATCACGCGTGGAGTTTGTCCTACAAAGGAGTCGAGCAATCGATGGTGAGGATCGATGAGGAGCTCCGTCGCC
ACGGTCCATTCGACGTTGTCATTGGTTTCTCCCAGGGTGCAGCACTGCTGACGATTTTAACGATGTGGTATCTGTACCATGGCAATGTACGTTGGTGGAA
GCTGGTGATTTGCGTTGGTGGAGTGGACGTGAGTGGTGTCAATGTCAAGTCGCTGTTTCTAGACAAAACTGGGAAGCGTATTCCCGTGCCGTTGCCTTCG
ATTCATCTCATTGGCAAGACGGATCCACTTTTCCATGAATCTCATCGGTTGGCTTTGTCTTGGGCGGACAAAGCGGAACCTAATGGTTTCCAGAAGGTCA
TCTACGAGCACGAAGGAGGTCACAAATTCCCATCAGTATCGAAGAACCATGAGTTCTACGCCGAGTTGGGTCATATCATCAAGAAACACTGCAACAAGGG
AACCGATGTCATTACGGCTAAGTTGTAAAAGAG