Description :
From Genome Similarity Track
Location :
scaffold_25:572848- 578284
Transcript NameFunction/comments
Plaha_PHALS_13731Protein of unknown function DUF1042
Plaha_PHALS_13732ribosomal protein l13

Sequence
5436 bases(100 bases per row)
GTGATGGCGGAGCAGCTACTACGCTGGCTCAATCATGAGCTGCAGCTGTCAACGCACGTAATTAACATCGAAATAGACTTTGCAAACGGTTACTTGCTTG
GTGAACTGCTATATCGCCTTAACCAACAACACAATCTCGCTGACTTTGTACGCAACTCTAGTGCTGACGCCAAGGTCATCAACTTTTGTCTTTTAGAGCC
TACATTATGCCGCCTCAATGTTAAATTTGATGCGAATGTGGCCGCCGGTATTATGAACAAGAAGAAGGACGTAGCTGCAAATCTTTTGTACCAGATCAAG
ATGGCTGCTGCTCGAGTTAGCAGAGCACCTGGTATCTCTACAAGGTTGATGGAGCGGACGGGGATTATTCCTCTGCATAATCGGCCAGAGAAGCTTGCTA
AATCAACGTATGATATGAACATGTCCCGGATATTTAAGCAAACAATTCGACGTCGTGTTCGGTCAATCAAGTCGCTGCAACAAGAAGAGTAATGAGAATG
GATTGTACTTGATTGCAGTGGTTTGACGCTTTTTTGAAATCGGTGTTGCAGGGATCAAATTGAAGAGGATAAGAAGAATCAAAGAGCCAATCTGGCGAGA
CTTGCTGAGCAGAAGGAGTATTTGGAGGCAACAATAGCAGAGAGAAGGCATCGTGCCTTCCTACATAACAGCTACATTCAGCAAGCTATAGGGGAGATGG
ACAAGGCATCGTGGAAAATGGCGTTGCAGAAAAAGAATGCTCGCGAGCAACGGCAAGATGCATTCTTTCGGCAGTTGACGAATAAACGGCAGGAAGAGGA
GGCGTGTGATATTCAAATTTTTGCGTGCTGATATTTTCTGACCGCTGCAAATGTCGGTGTCCGTAGAAATCTCTTGCTGCTAGCTTGCGCCGAAAGGTGT
GCTGTGATCTTAACGAATTTGATGTACGTATTGCTCGACTTTGCTCACAACTTGTTCGTTCTTTTACGGATGTACTTATAAGACATCGATTTTATACAGA
CAATAGGTGAATTGAGAACCGTAATGTCGGGTTGCAATATTAGTCCGCGCAAGTCGAAAGGATTTGGCCTGCGGTCACTTACCACAGCGCTCAACACAGC
ATTTGAGAAGGAGAAACATCTGACACCGAATTTTGCGATGAATGAAAGAGAAGTACAACCAAATCCGTCTGAGACGGCAATCGCAGCAGATGTCATTAAG
CACCAGCGGCAGCAACGTGAAAAACGCAGGAAAGATCTAGCTCTAAGAAGGCAGCGGTTTCTCCAAGAGTGTGCTTTATCTCAAAATCGACTACAGACCA
CTCGTGAAGCGAGTTTATCGAAACAGTTGGTGCTTCAACCTACAAATAGCGAAAAAAGTCAAAACAGTGAAATAAATTGCATTCTCGCGTACACGGATGT
AGCTATTGAAAATAGGCTTGTTCGGAATCGAGAGTATGTGAAACAGCAAGAGTTGGACTTGTTGGCTACGATTGATCGTGATGCATGCTATTACCGCAGT
ATAATTCATCAATTTGAAGATGATATCGAGATGCAGATCGTACAACGAAGTGACGTTCAGGCTTCTATTAACGCTGCAAGCCGATTTGCAAGTGAGCAAA
TTTCAAGTTTGATTGTGGATGATTTGATTAAGTTTGTGctatttattgcaaaaaagCGAGAAGAAACTTTGCATCTTCGGGACTCTGACATGTTTTTGAC
GTTAGAAACATGGGATGAGTATAAATTTCAATTCGCTAACGGTTTGAGTTTCGAAGATTTGATTCCTTGGTTCGCCGTTGAAGCATTCGGCGAAGATACG
TCACTGGATAGTCATGAACTAGATGAATATCTGTCGCGATTCCAACCACTTCCGACAATCTTGGAACAAATACCTCTTTCATCTACGAGGAATGAAGACA
CACTTTTTCCTGGGGCGACCGAAATTATCGAGGATCATTTTGTGCTTGGAGAAGAAGTGAAAGCTTTACGGTGGATTTCGCGTCTCTCGCCAGTCTCTGC
AGCCGACATTATTCAGGAGAAATGCACCTTCGACGGATCTAGTGCTGAGTTAAGCCTTGGCGATCCCGTTCGGCCAGCAATAAAACCTCGTCAAGAACTT
CGAATTCTTGTCTTTGGCCCTCCTTGTTCCGGTAAGGCGACTTTAGCGAAGCTCTTATGTGAATCGCATAATTTGGTCGTGATATCAGTCCATGAATTCA
TTTTCGACGCTATTCAAAGCTCAAGTGAGCTCGGTGATCAAATAAATGGTTTTCTTATCAATGGAAAGGAACTTCCTCCGGAGCTTTACAGCCGCGTTGT
GATTGAAGCAATCAAGAAGAATGATATGCAAGACCACGTACGGTATGATAAAGCCGGATGGGTAATGCATGATCTGCCTGCAACTTTACAACATGATCAA
TATCTGGATCAATGCCTTACAGGAGATATGGATGTGGCTGCTCCTGAATCACCATATCAATTTATGTCTGCTATCGCTTTGGGTCGACCTAGACCTCCGT
TGTCTTCAGCCTTTTTTCATGGTAAATCCGGTATCGATCTGGCTTTACACATTGAGGTTCCGACCAATGCTGTTTTGGACAGATGTTTGGGAAGAGTTGA
GGACTGCGCAACTGGAGACAAGTATCATTTAGTATTCGATCCACCGCCGGATAAATCGACGGCACGTCATTGCTTACGTCATGTCAATCCAAGCACATAC
TCTAGTGAGCTTTTGTCGCTTCATTGCTGGGCGAAAGATGAGTTTCAGCATGACCACAAGGCCTGGTACAGAAAATTTGACACATTGCGTGAGCTTTCTT
GTGCCGAGATGTCTATGGCCGAAATGCACGAAGCCATTGCCAGAATCGTTGACCAAGTTCTGAGAGATAGACAAAGGAAAGCTGAGGTGAAGCAGCAAAA
GCAAGAAGCAGATGAACAAGCTTTAATGTTGTCCGAGGAAGAacgacaaaagcgctttaaTGTCTTCGAAACAGAAATTTACGAGACTAATGCGACAGTG
ACAAAAATTGAGGCTTCTTTAGCAGAGGCGGAGTTagccaaagtcaagaaagaaGAGATTATGGAGCTTCGGAAGAAACTAGACGAAGCTAGGCGTCAAT
TTGATGCTACGATAGGCGCCGCACGATGCTGGGTCAACGGAGAAAAAGTGTGTAACTTTGTGACAAAGAGCAAACTTCCCGGTGGACTCTCACTAGCATC
TGCCCAAGTTTTATCGGCGATATGGAATAATATGGAGATGGAGTATGTATCAACAGTAAAAGCGAGTTTTTCCATGCTTCGCAAACAGCGACATCGTGTG
ACCGATCGCATGCAACAAATAATATGTAAATTTTGTGAGTTTGTCCGACGTCCTGATAAGAAGCAGTTGATCGTTAATGAATTTCAATCTTCGTTTAACG
AAGTAATTGATGAGATGCGCTTTGAAGAATTTACAAAGGTGGAATTGCATGCACGTACAGATATTTTTCAGGATAATTTAGTGACTTTAGTTGAGGCCAA
AGTTAAAGAGAATAATGAGGAGCTCGATAGTATGATTGACGATAAATGGGTCGAAGACATGTGCCAACAAGTTGCTGTGATTTATCAAATGGCTCTCCAA
GCAGAACGTGATCGCTTTCAAGTATCTGTTCATGTTCTTCTTGATGGTCACTACGTTGCGAGTTCAAATCGGTCTCAGCTGAAAAGCATTGTCGAGTTGT
GGCAAAGTTACCGATCTCGCTTGGAGTCGCCTTGCACCGTGTATCGCAATTCAGTGGATGATCTTTTGATTAAAAATGCATCACCACCCGTTGCAGCAGA
TAAAACATCCTCGAAAGGCAAGGCGAAGGCCTCTGCTCCTGCCGTTGTGCCCTCAACGAATGTCACCGCTACGATTGTAAATGCGCCAGCAGATTCCTTA
ACAATGACTGAATTATTGGCCGAGTATACGCACGTTCTTAAGCTTTGTAGCTCGTGGATGGAAGCTATTGCTCCGATTGCGAATGCTGCAACTTCACAAG
ATGTAGAGAGTGAAGCTGCTGACCAACAAATTAATGGTGATTTCTGTATGGCCAACTTGTTGAATGGACTCAAATATGAATGCAAAGCAATGGAGCGACG
AGTACAGTTTCTACGGGAGTCATCTGAAAAAGCATGCAATGAGATTACGAAGTCAATGAAATCAATTGAATCTACTCTGCGAGACGTGCTCGAGAAACGA
AAGGATCAAGAAGAGATAGCTATTGCTGCAGTGATTGAATACGTTCGTGCTGCTATTGAACGTGAAGTTGCCCTCCCATTGTACATTGATATCAGCGTAT
GTGATCCGTCGACGATTGTTTTATTGATACTAATTAATTCATGTTGTtatgttttgctgtagcctgAAGTAGTCAAGCGCTTTCCCGTAACAAGTGAATT
ACCTGAAGACACGATGGTTCGTATTGACGGGAACAAAAGATTGCTGCCTCTACCTATCCCAATTCCACCGCCTTGTGTGGAGGTATCTCATGACCTACTT
CTCAATCCTCGTCAAAGGGATAGTCTTGAAAGCGCATTAATTGCTCAAACCTACAACGACTCTGGTCTTCTTCCCTATGTCGTGGTTGTGGAAATAATTG
CAGCGTTGCCATCTCGCCTCAATGCGCTCCCAAACGCCTGGCGATGGTGCCCGCCACACGTCATCGCAGAGGTACGAAGTTATCGAAACAGACCTTGTGT
ATCTAATATCTAATCATTCGTGGGTTTAATGTGGAAAGATTGTCGCACAATTTATTGTAAATCAGTCGGAATTCGTCGACGTCAAAGCTCTGATTGATGC
TATGAGCTCTCGTGATGACCTGCTCCGTCAGTTCTTACCATTTGAGCCTCAACAGGATCTGCAAATGcatgaagaaaaagaacAAAATCTTTTATTGCAG
CAAGAGACACCAACGAACGATTCGGATGCATCATTATTACAAGACCAGATATAGTCATATCTCCTCTCTTTGCTTACAATCCTGTCTTTGGTATTTAAAC
GCGTTGTGGGATTTTAATAAATGACGGGATTCTCTCCCACCTCTTTGACAAAGTCGTGTGTTTCGCCCATAAAGATCTTGAGCTTCTTGTCTTGGAGAGC
GCGCATCCTGTTGCGGGGCAGCATGCCATAGACGGCCTTGCGCAACACTTGTTCAGGTTTGCGCTCGAGAAGTTCCTTGGCTGTGCGCTGCTTGAGTCCA
CCAGGGTGGCCAGTGTGCCAACGATATAACTTATTGTTCCACTTGTTGCCCGTGAGCACAATATCTTTAGCGTTGATCACCACCACATAATCGCCACAGT
CAGCATTGGGTGCGTACGTTGGTTTGTGCTTGCCACGCAGAATAGGAGCCAGCTGAGAGGCCAAGCGACCTAGCACTTGTCCCTTGGCGTCCACCACGTG
CCACATTACCTTGGACGCTTGCGCAATTTTACTCAT