Description :
From Genome Similarity Track
Location :
Scaffold_110:57280- 60120
Sequence
2840 bases(100 bases per row)
CTACCTCTTGACACTGTCAGCTCTGTCGGCAGCAACAAACTGAAGAACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCA
TCGACCTTCCAAGGTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACTCGCAGGGGGTTGCTGACTCGCAGTCCCCCCT
TGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAGGAC
CGTACGCCGGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCCGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGC
CGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATCATTCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGG
TGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGACCCGCAAGACGAGCGAGCTCGCCCTGATTTCCGGCCTGGGCGGCAGCATTACCGCCAGTCC
CAAGGCCAAGTGCAATCTCAAGCACGAGGATACGTTGACGGAGGCGATCAACCTCAGGGTCCTGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGCG
GCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCTCCCCTGCTTGACCGGAATGGGGAAGTCCATTCCACGTGGAGCGGATCCTCCAG
GAGCAACGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGTAGGGGCTATGCCCACTCCAAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACT
GCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGACGATGAATACATTCCG
TACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCACTTCAGGATGTCCCTTGGCAGCATGCGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCAC
GCTGGTCCAGGATGCGGGACAGCAGCTGATCTTCATGGAGTTCCCGTAACTCCGTGGGTGAGTACTTAAGAGTCTCCACCCATGCCCAGAACATGTCCTC
ACAAGAACTCCACGTGGGACAGTTCTCGGGCATAGCCCAGGGGTATCCCCAAAGAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTG
AAGTCCTTAAGGAGAATGCGGTGTGGCGCGAGAATCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAACTGTTCGTTCTGAACAAGGGCTCGTTCAT
AGATGCCCCTAGAAGAGTGGCCGCCCACAAGGCCACGAGGAGCAACGAGAAGCTCTAGGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCC
TCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCACCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAACTCTTCCTGCTGCTGGTCGAGGTCA
TTCGAGACCTCCCGTAGCTCAACGATAGCACCCTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGTCGAAGATACTCTGATAGGAAC
GACGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCTGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCACGCGCAAGCCC
CTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCCACCGGCTTTGGGAGCGCCCTTAGTCTTGACGGCCGGACGCTCAGAGCGCACAGAG
GTTCTGGGACTGTGATCACCTTGATCACTAGCGAGCGACTGCACGCTGTCATCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAG
GAGCATCGTGAGTGCTCTCGGACTCGGCATTGTCCTCACTGCCCGAGTTGAACTCACGTTCCACGAACCGAGGGATCGGACGATTGTCCGAAGATGAGGG
CGACGGGCTGCGGCGCTTGCTTGCGCGCTTGTCCACAGCCGCGTCACCCGAGGAACCGATCGCCTCGAAGGCCACCTGAGTAGCCTCCTTGAGTGCAGAG
CCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCTTACCGGCAGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTTGCAGTGCCACTAGGCATGGTAA
CAGTCGAATTGGAGACCTAGACGAAGAGCGCACAGGTTGCTGCTCAAGGCTCTAACTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGT
TTACCACTTTGAGAATGAGAGTTTGTGACGAACACCTCTTTATTCTGATTGGTCAATAAACCGTACCTAAGTGGGGGAGGCTGTAACGGGGTACGTAGCC
CTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGTGTATGACACGTCATACTCCGGGATATTTGGTACAGGGTACCAAGGTCGTTCAA
AGCCAAACATTGGTCAAACGACTTGCATTTCTATAGCTAACTTATAGTTTGTATTAAACCCAAACTTAACCTACCTATAAATATACTCAGTTTACAATCT
ACCTTATTTAGGTCACTTCGCTCTCTTTAAATAAAGAGGGGACCTGTGAGCTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGC
GCAAGGTGCTGTGTGACCCCGTCACACTTTATGTCCGCCC