Description :
From Genome Similarity Track
Location :
Scaffold_624:5728- 7834
Transcript NameFunction/comments
Hyaar_Emoy2814383hypothetical protein

Sequence
2106 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNAACATGCCAGGGCCTCTTCGAGGTTCGCGTGCAGGTGTCCTTGCGTAGTCGAATTCGTCTCTCCTTTAGCTCGTGCGGT
CGTCAATCGTGGTTCGGTCTTGATTGTTTTAACTCAATCGCGCAGATGTGACGCCCTTCTTGGGCCTAGATGCATCCTCTGAATACCGATCGAATTGTCA
GAATCGATTTCGGATTCAGCTGATGCGTACTGCGAAGATCCAGTGAGATATCTTCTCGAGGCGTCTGCGATCGCTGTGTCCGCTTGATCCGTACGATCAG
ACTTGCCTGTCAGGGGAATTAACTTTTCGTATAGCGATCAATACACTTGGGCCACCTGATCTTGATCGCACTCCAGCAATTTGTTCGCGTCGAACACTCC
GGTGACAAAACCAGCTTCATGTAGCAGCCGCATCATCCCGTTGACCTTGTCCAGCGTATTAGACGCTCCTGCCGGTGGGGGGTATAGGGCCTTGAATCTC
TCCAATCAGATTGGGCTTAAGAATCTGGATCACTGGGTCGCTTGATAGCAGATTATTGAGTGTATTCCAGTGATATCCCTTCGCCAACTGATCTAGCTGC
CAGCCATCCATCTTCATATTGGGGTCCACGAAATGGATCGGGCTATGGATCGAATTCAAGCCGCGATCGTGCTGATCCGATCTGGACGCTTCTTTCTTCA
CTCGTGCTGTCTTCATTCTTCGTCTTTGACTTTTCTTGAGTGGTCTTGAGTGATAACTGTTCGGTTTTATCCGAAGGTTTTCACCCAGCAGATCGTGCTT
TGCGGCGCGATCCGCGGTGTTCCCCGAAGGGACCTCAGGAGGGGGTCGAGTTTTTTCTTCCATATCGATCGATCGATCTTCCTCTTTAATTTTCTTGTCA
GCAGAGCCCCTCCTAAGACTCCGATAATCTGGCGATCCTTTAAAATCACGCGTCGGCGGCGATACCTCTGCATCTGACGCTTCCATCCCAGGTTCCGTCT
TTATTTTCACCTCTTCCCTCCAAGACTCACGGTGAAATCCCGAGCCACCGGTAGATCCGGGCACGCGGACCATAGTGGTGGAGTGACGATCGCTTATTAT
ATGAGGCGATGTAAACTCTCCACTGGCGCCCAGACGACTAACTAACGGAGGGGGTACTTCGATACCGTGTAGATATATTCCTTCCTTACCTTTTGTACCC
GCCGGTAGGGCGGGTTGCACTCTTCCCGGTTTACTCGTGTCGAGGGAAAACTCGACCGTGTTGGGGATAGGTTGGTGTGATCGTGCGGAAATCGTCACAT
GATCACGGGTGTACTGGTAGGGTATTTGATGTATGTCACCCAGATCTCAACGAGATCTCCTTGTCCAATATGTAGATGCTTGAAACGCTTGAAACGCTTG
ACCTTCTGACCACTTGATCCGTCTCTCGATCTTGCACCTAGTCCTTTACGTTCTTGTTGCGTCCAATCGCAGCTGGGGTTGTACTGATAATTCTTGATCC
CCAGCCAATTATCTGGGGAAATCATTTGATTTCAGTATGTGAGACTTTCTTGACGTCGAGAGGCCAAATATCCAGCGAGGAAAAGAAGTCGACACGTGTA
CTTAGAAGCAAATAGAATTCTGTTTAACGTTAACCAACCAAAAGCTAAAACTACCATTGTGCCTCTCTGTGTACCAGGGTATGCTGCCACATGTCTTCTG
CATTCCGCTGATAGTTCCTTAACAAATGTGGTTCACTCCTGATCGATCGTCGATCACCATCATGGATCGTTGATCACCATCATCGATCATCGATCCCCTT
GATTGATTGTCGATCACCTTAATTTATCGTCGATCCCGTTGATTGATCGCCGATCCCGTCGATTGATCGTCAATCACCCTGACAGTTGATCACCTTGATT
TATTTT