Description :
From Genome Similarity Track
Location :
Scaffold_1:5726240- 5734007
Transcript NameFunction/comments
Physo_470983glutamine cyclotransferase
Physo_468295ferric reductase, putative

Sequence
7767 bases(100 bases per row)
GGTGCCCTCCTGACGCACCCCATGGGTGGTCGATTGCTGCTCCTGTTGCTCGCCGCCCTGGCCTGCCTCAGCTGCGTAGGTGCGACTGGCGACGGCACCC
GCACAGCTGTGCGTCTCGTAACCATCCACCCGCACAACGTCAGCGCCTTCACAGAGGGACTCGTCTTCGACGACGGCGCACTCATCGAGTCCACGGGACT
CAACGGCGCGTCCTTCATCCGCAAGTACAGACTGTCGGACCTCAATCCCGAGTTCTTCCGGGCGGGGACCACGCAGAGCGTGCCGTACTTGCAGGAGTTC
CGCTTCGACGATGCCATCTTCGGCGAGGGCGTGACTGTGCTGGGCGACAAGCTGTTCGCGCTGACCTACAAGGCTGAGCAGGTGCTGGTGCTGTCTCGAC
GCGACTTCCAGCTGATCGGTCAGTTCCCCCTCTCAACTTCCACCAAGGAGGGCTGGGGACTCACCACGGATGGTGAGTTCCTCATCGCCAGTGACGGTTC
CGCCAAGGTGCTCTTCTTCGACCCGCACAATGACTTCAAGCTGCACCACAGCATCACCGTTCGCAAAGACGGCGTGCCGGTCACAAATGTGAACGAACTC
GAGTTCGTAGAGGGAGAACTGCTCGCCAATGTGTGGTTTGAGGACCACATTCTGCGTATTGACATCGAGACAGGAGACGTGCTGGAGCAGATCGACCTGG
ACTGGATCCCCAACATGGTGGCCAACATTCATACCAAGGCCATGAAGAGGTCACCCATAATTAAGGATGCAGTGATGAATGGGATTGCCTACGACCCGGT
GAGCCGTCACGTGTTTGTGACCGGCAAGCTCTGGGACTCCATGTTTGAGCTCGAGCTCTCGTACCTGAAATCCCGCGAACGATCATTTGCCCCTTGAACT
CGTCGAAACTTCGCCACAAGTACCGACCGGCATCAGCGTAGTACTACTCTGACGAAAGTTAACGATTTCACACAGGCAGCATAAAAAACTTAGAGCAAAG
ATACATGCATTCGGCAAACAGCACTATGTAAGATACGACAATATCGGCTACATCAAGACATGAATATGCCCGCTTTCGATCAGCAGGAACTCTGGCGTTG
GTTCATCCGACGTCTACGCAAACTTTTCCGAATGGAAGTCGAAAACGGTGCCGTCGGCCTTGGAGGACGTGTACTTCTTGCACACATTGGCCAGAACTTC
CTCCAGCTCGTGGGGTCCACAGCAGAACACACCCACTTCCTCACCAGGGTGCTTGGCACTAGCATCCGAGAAGACCCTCTCCCAGTCTGGTCGGCCAAAG
TGCGTGAGCTGCTTGGTATCCATTCCAGACACGAAATCCTTGCCCGTTTGTTCATGAACGAACTCCTGGAACATCTTGAGCTGCGAGGTGTTTTCTTCTC
CACCGAGCACGACGGTACTCAGGTACTGGTGCGTCTCGATCACATTGTCACGGTCCATTTGAGCTATTTGCTTCATGGTGCCCTCGAACCAGCTCAGTGA
TTCCTGACCGCGAGTCACCCAGTGGAAGTACAGCTTCTGGATCTGGAACGAGCTCGGGTGTCGAACGTGGTTGCAGTTCAGGCAGCGATTGTCCTCCCAG
AGGTGAACAACATCCTTCAGAATGGAGGCGAACGGGGTAACTCCAATGCCGCCACCGATGCAAATGACAGTCTTGTAGCGGTGGTAGTCTTGGGTTGGAG
CACCAACAGGACCGTCGAGGTACACATCAGGGTACTGCAGGTTGCACGCGTGGCAGTCCGCAATGACACGAGCCATTGCATCAGTCCAGTCACCACACAC
ACGAATGTGGATGCTGATGTAGTTGTCACCGGGGGCTGACGAAATTGTGAACGGGTGCCATTCATGGGACGAAATCTGGGGACAGTTGATGTACAGGTAC
ATGCCAGGTCTGTAGACAAACCGTCGGGGCTTCTCGATAAACAGCGCAACGGTGCTGTCCAGCTCCATCGCCTCCATGATACGTACAGGCGCTGCGAACA
TCTTGGCGTAGCGGAATCGACGCTCGATCAAGTACATCAAGAACGGAGGCGTGATCCAAATGTACGCCGAGCAGCGAGCGAGCCATGATGTGGCTCCATG
GAAGGCCAGCACAACCAGGAACGGCCCGAAGAGCATGTGCGAGTACCAAAAGAGGTTGAACTTGCCCTGCCGGAACTTGGGGATCGCAGCGAGCGGGAAC
GAGATGCACGTGATCACCAAAAGAATCACACCCGTCCACACTGGAAGTGCTTGCAGCATTGTCGTGAAAGGAGGACGCTCACCATTCACGAACGTTGAAA
CGTGGCGGGTGACGAAGATTGACCGCTTGACCTCGTCTGGGGTGGCGATCAGGTACAGGTAGATCTCGTTGAAGACGTGGGCGATCGTGTGAATGAGGCC
AGCAATCAAGAGAACGCTACCGGAGATCTTGTGGAAAGCGATGTGGTCGTCGAACGGAATGATGCGCCACAAAAACTTGCTGCGCTTCATCACCTGCGTA
ATGGATCGGCACATGGGGAGCAACACGAACACGCAGTTGAGCATAGCGACCTGCGCGTTGGCGCGGGCGATGCGCAGACCCCAACCAATGGCCGGATCGA
CCTCGTACATGAACCACTTGACCCAGAAAGCGATGTTGTTCACAATAAAGTAGAACAGGAGCCACCAGATGCGGAGCTTGTTGTCGCTGTACCATTGACC
AAACTTGCTCTTGGGGCGAATAGGTGCCGAGTAAACCGGCTTGGCCTCCTCGAGGTGGTACGAGTCCGTCACGTACGGCTCAAACACGTTGCAAAACTGC
TCGAAAGTCATCGCGTCGTTTTGAACTCGAGCTTTGCGGAACATGAGCTTCGCCACCGTCTGGAATTTCATGCCCACCACGTCGATCCTCGCACTGGAGA
AGTTCGACTCCAGCAACTGAACGATCTGATCTTCGACCACATAACCCGTGTTGTCGGGGTCCAGCGTGTCGAAAATGAAGCGCAGCTTCTGCTCGGCGTT
CACTCCAAGCTTCATCACGGCGTCGATCAAAATGGCATTGCCGTCGATCGTACCGTTGCTGGTAGCATAGCCATCGAAATCGTTGCCGTCCACCTCAAAG
GCATGCGAAAAGGTCTCGCGCTCGATGTAGCCATCCTTGTCGGTGATGTTTCCCATCGCGTCACGGAGTGCTTCAAGCTTCTCCATGGGCGTGTAGGCCT
TCTCATCCATACTCATGGCCACATTGTACTTCTGCTCGAAGTTGCAGTCACCCGGGATCGGCACGGTCACGACGTCGCTTCCGGGAGGTGGGCCGTACAT
GTCGTCCTTGGGTGCAGGTGGAGCGACACGGCATTTCATTCGTGGCCCAGTCGAAGTCATGGACACACTCGACGCTGACAACGTCAAGCTTTGACGAACC
ATGTTGGAGCGCATCATAGCGTCCACATTGGCGCGGCGACGATGCGATCTGCGATTGTTGCCGCTGCCTCTGCAGTTGCCTACCGCGGGGGTCGTGGTCG
AGTTCATCGACATGAACTTGCTGCTGTCCATAAAGTTCGCAGTTGCCGGCTTTCGGAGCGGCGGGTTCTGGTTCATGTTGACCATCGTGGACATCATTGG
CGTCGACTTGTCACCGAAGCGAGGAGCATTGGGCGACGGCGTCGACACGTCAATGAGGGCCTGCGTCTTGGCCGGAGTGATCTTGAGGTCGTTCTTAGGC
TTACCACGCCCAGGTTCTTTTCTCGAGCGGTCCATAGCTGTTGTCGCCAATGCACACCTAAGTACCCTTGGAGTTGGACTGCAAAAAGCAAAGTGGAGAA
CTCGAGCTGGGCTGTTGAGGCTCGCACTTGACACTTTCGTGTCGCCGTCCCAGCGGTGTTTGCCGAAGGGAGCCGCGATGGTGGGCTACAAGTTCTGTAT
GTAATTCGAACAACTAGAAACGCGCGCTACGACTATCCTCCAAGCAAATAAGGATCTGGCCGGAGAAGAACTCAAGGTCCGGGAATCCGGCCTCTACCAT
CGCTTTACACGGACACGCTCGCCGCCTCGGGCGCTCACTTGTGTACTGCGAGGAGATCGGGAACTCGCCGCAGCATAATGACGAGAAGGCACAACACAGC
AAGCTCGCTCGCCACTGCCAAGCTTTTTTCGGTGCTAATCCGTTCAACGCGGTTACTTTGCAGCCAACAACGCAGTACGGTTGATACATGTGTTGCATTC
ATTGACCGCACCACGATTGATGGTGACAAGAACAATGAGCAGCAAGGCAGTGCCCTCTCGACGACACAAACTGGTATGATACCTGTACGATCCAGTCAAG
CAGCAAAGTCTGCTCCGCCTCGTTGAGGAAGTTGGGATTATTATGTATCAAGAGCTGCACCGCAATTTACTGCACCAGCAGATTGGCCTTGTCCCTGCTG
ATTAATCCGTGCATCGCTACATCCTCCGCGAGTTAAATGCCAGAAACGCGCAAGGATCAGGATCAGCATTTCGGGCTGTTCTTGCCTTTCCTCGAGCACA
GCCGAAGATGCCCATATAAAGATGTCCGAGCGCGTTTCTAGTTTCGGTGTCGTCGAGCGTCTTAGCTCACCTTGAGCGGGTTATCCTCGGTAAAGGTGCC
TGCGCTCGTCGGCGCTACATTTTGCTATCGATTTGTAGCTCCCTCCAGCCCACAACATGATGTAGTGCAGCCACCTGGTCCCCGATTATTACTCGTGTGA
TACGACTACAGCTGGAGCAACGGCAACCGACCAGTGTATCCTGGACCATTTCGGTGTGCTCGACAAGCGAGCATGCAAGCAGTGCTTGCATACACGTACT
CGCATTGGTCACCAATTTGATACCCGCAAAGTGTGGCAAAGTGCAGTCAGCTTATGGGACCCTATCGACTCGGTTTTAAGCTCACGGAGATTGCACTCGA
ATACCTGCACACTTGTTTCGCCACTTTTGCGGGGAAAGGTGTTCGGCTGAGCCAAGTGTTTTTTTGTTGTTGTTTAACTTCCACTTTCCATTGGCACCCC
AAAAGGACAAGCAACCGTTCTGCCTCAACGTTGAATATACAAGTTGCCAAGTGGCAGAACTCACTATATCTTCTTTGTTCAGCTGGTAGTTAAAACATCG
CTAAGTTCATCCTGCTACGTGTACGCGGCACGATGGTGGTGAGCACAATCTTAGCTTTAAAGTTACGCACGCGCACTCACCTTTAGAGGACTGCGGCTTC
TTGGGCGGTTTGATAATCGTTTACCTTGGGGTAACCAGAATCCAACGCTTGGTTCACGTAGTGGATAACGATACGTCCCATCAGGCAGTCGCCGACTACT
AACCTCTGAATGGCTTCCTGGCGACGGGTAACTTTCCGCACAGGATGACACACCAGGATCAAACCCGACCTGTTCGTTGCTACATATGAAGCTTTGCTCT
TCGTCGCCCTCTTCTTCCTCGTCTTCTTGCAGCGTGAGCTCGTGAATTGTAAGCGCCTGCTCTTCAAGACGTTTTTTCAACTTCTGTCGCTCCAGCTGCA
AGGTTTTAATCTCGCGCAAAAGTTCGCCTTCGTTCGTCGTAGTCCTTTCATCTCGGGTTCTGGCCTTCAATCGTGTCACCTCCTCTCGGAGGACGTCACA
TTCCTGGCGCAAGGCAGCTATGAGGCTGGTGTACTCGGCGGGCGAGGTAAAATTGTCTCCTGCAGCTATGGATGAGTCCGAGAAGGTGGACGAGTCGACG
TGAACATCATTCAATGAGAGCTTTGGCACGTAGGTGCCACTGGCTTTTGCTTGCAGCAAGTCATCTATTGTATGAGCCTGTTCCTGCAGGGATATCGACA
GCCTAACGTGAGTTCCGGTTGACGTTTCTTTCTCGTACATGAAAGCTTACCTCGATCAAAAGGTTGGCACTCAATTGTGCCTCGACAATTTCGTTCCAGT
GCTTCGACTTTTCCTGTTTAAGCAGCTCATACTGTGCCAGGAATTCTTCGTATCGCTGCGTTAGCTGCTCATGATCTTGGGCAATGGATTGTTTATCTGC
CTCAAGATTGCGAATTTGTTCAGTCAAAGTTTCACGCTGGAGAGGCCACAACGAGCATCGTAAGTGCATAAAATATTGCCTCAGCCGAAGATTGCAGTCA
ACACACCTCTTCCAGATGAGCGGCTTCTAGCTCCTGAAGCTTCTTGCTCTGATCTGCTGTCTTCATACACGCAAATGCAATTAATTACCAACCGACCTAC
CCTCGGTTGAATTCAGACAACTACTTACCACAGCAGTCAAGCTCGTTAAATTCTCAACCAAGTCTTGCATCGTCTTCTTAGTCCCTTCGATTTGTTGGGT
CTCCTCGTCTCTCTTACCATTTATTTCCCGCAGCTTGGTTTGAGTTTCTTTCAGCATACTTGACAGCCTTTGTTCCGTTTCCTGAAGGTCTTGGTGTTGA
GCAGTCACCGTCTTGTATTTTCCCCGCAGTACTTCATTTTCCTCAACAGCAGTTTGCAGTTGCTTGCATGTATCCAAGTACTTCGAGTTTACTTCTTGAA
AGCGGTCCCAGCGCTCCAGCTCCAAGTTTTTCGTTACTTCAAGCCGCGTTTGCTCTCGGGCCGCATCAAGCTTTAGCTTCTCGTCCTGCTGCTTCTGTTC
TGGGGTTTTTAAACACTGTGGACACGTGGCGCTGATCTTCTTGTGCTTCTTCTCAATCTCCCAGCATTCCTGTTCCTTGGCTTTTATTGCTTGCTCGTGT
CGCACCTTCACTTGCTTCATGGCTTGGTAGATTTGCTCATTCTGCTGCTCAATGCATGTTCGCGAGCGGAACAAGCCGTTATAGTCTTCTTGCAGCATCA
TCAGTTGTTCTTTTGAATGCTGATGGTTACGCAACACTTCTCGCCACTTGTCCTTCATATGCCTTATCATCAGAGAGTGTTCGGCTTTGAGTTCGCTCTT
CCCGTGCAGTGCCTCTTGTAGCGCGGTCGACAAATCTGCTACTTTTCGTTTGTACATTGTCACCTCTCCTCCCATTTTTTCCTTCAACTGGAAACTGGAG
CGCTCTCGATAGCGTGCGTCTTGCAACTCCTTGTCAACCAGCTGCAGCCGAGTCTTGCACTTTTGCAGTTCATCCGCCATGGGTCGGTGTACGTTTTGCC
ACTCTTTCCGCTCGCTTTCCAGTTTACATCTTAATTGCTCCACTCTCGCACGCAGTGCTTGGCGCTCTTCTTGAGTAGCGCGTACGTTCGCCGCTGCCTC
CTTTTTCACCAGCTCCACCGTCTCGTCGTGCTTTTTCTCTAGCGTCCGCAGTTTCTCGTTTAGGCGGCTCAGCTTCGTTTGGTCCTCTTGTCGCTGGTCC
AGTGCTGTCTCGAGCAGTGAGCTCGTGTGTGTGAATTGCTCTTGGAACTTCGTCCGTTCGGCTTCTAAGGCTGCCATAGCCGTTTGTAGTGTAGCAATCT
CGCGCTTGAGCTGAATCGTGTGCGCGCTGGCAGCGGCGGCTGCGCGGGCGGCTGTCTGGTCCTTCTTAACTAGCTGTTGCCGCAACGTCTCGAGGTCGCG
TAGGAACGATTTGCGCTCCTGCAGGTTGGAAATACAACATCAGCACATTGGCACCTTGCTGATAGATACAGTTTTCGTCTACAGCTTCAACATCCTGAGA
CGAGGCAGAGACTGGGTACCTTGTCGAAGCACCGCTGTGCGTCCTTCAAGGACAGCGTGGAGGCCGCGATCATGGCTTCCTTCGCCATGCTCAACGGATG
GGGTGGCACTTAGCACCCTGCCAGCACTCACAGCGTGAAGGAGGCCACAAGCGACGCTAATCCTGGC