Description :
From Genome Similarity Track
Location :
Scaffold_4:572502- 578221
Transcript NameFunction/comments
Physo_545737LOC100004107 protein putative
Physo_28747640S ribosomal protein S25, putative
Physo_505837peptidyl-prolyl cis-trans isomerase D
Physo_316008conserved unknown protein
Physo_560822Hypothetical protein

Sequence
5719 bases(100 bases per row)
TTGCGGATGACGGCACTGCGAGCCTTGTCGTCTTCGTCGTTGCCACTGCCAAGGCTCACATAGTCTTCCTCGCCGCCGTTGCCATTTCCAAGCGACTTGA
AGCGAGTCACGTACCGCTTGAGATGCCGCCGAATCTCCGTAGCTCGCAACAGTGCGCGATGGCTCAGCAAGTACTCGTCACACCACGAGCGGCTTTTGTT
GTTGTCCACGAACTCGTCGTATATCGCCAGGTACATCATGTGGTCACCATCCGGATGAGCAAAATGCTCCATGGCCTCCGCGATTTTCTCCTGTCGCTCT
CTGGAACCGCGTGAAGCCAGGAAAACATCTCCAACTGATAAGACACTGGCAATGCTCAGTATCTCGCGTGTACAGTCGAAGCGGAACGACGACAACAGCA
CCTTGGCGAGCGCTGGAGCCACTGGAAACTCGGCCATTTGTGTGCCCAGTGGATCTACGAGACGGCAGTCCGTGTCGATGGCTCCAAGCGAGAACAACAG
CTCCAGAGCGCGGATCAGAGCTTCTGGCGACGGAGACGACACGAAATCGAAGTGTGCCAGGTCCTGAATGCCCATGCTCAGCAAGTACAACGCCACGGTT
GCCAGATTCGTCCGCTGCATCTGCGGGATGGTTTCCTTGGCGAGTTTGGTCCGGAAGTGCTCTTGTGTGCAGAGGCGAAAGCACTTCCCGGGGCGTGACC
GACCTGCGCGTCCAGCTCGTTGCTTTGCCGAAGCCTTAGATACAGGCGCTGTAAGCAACGCCTCCACTCCTGTGAGCGGGTTGAAAAACGCAAGCTTGGT
GAAGCACCCGTCCACCACGAAGACGACACCCTCGATAGTCACGGACGTCTCGGCGATAGTGGTCGCCACGATCACCTTGCGTCGCACTCCTCGAGGCGCC
GGCAAGAATGCGTTCTGCTGCATGTGCAGTGGCAGCGTCCCGTACAGAGGCACAGGCAGCATATGAGTTGGGGCTCTGTCGTTGAGCGCTCTGACGACGA
AATCGATCTCTTCTTGGCCAGGTAGGAACACCAGTACGTCACCTTCCCCTTCACGCTCGTCAATTGCCAGCACTGTGTCGATAGCTTTCTGCAGATAATC
GCCACACGGTTCCTGGAGGTACTCAATGTCCACGGGAAACTGTCGTCCTTCCACTGACACTGCAACGACGTCCTTCAGCACCGGCGACGACTTGGTTGAC
CCAGTTTCACCGTTCTGCCCCATATCCTTCCTCTTTGAGCGGAAGAACCGCACGAAAGTGTCCACTTGCAACGTCGCCGATGCGATAATCACCCGCAGAT
CCGGCCGCTTCCTTTGGATCTTCTTGATCAGCCCGAGCAGCAAGTCCGTCTCCAAATTCCGCTCATGAGCCTCGTCCTAGAATCAAACGAAAAGAACCCT
CAGTTAGTACATCACTTATATCTTAAATCCTGGCCACACACGGTTGCCAACATACCAGCATCACGACTGAGTAGCGCGACAGCAGCGGGTCCCGCATGGT
CTCTCTCAGCAGCAGTCCGTCCGTGACGAACTTGATCTTGGTGCGCTCCGGGTCCCACTTCTCCTCGAACCGGACGGCGTAGCCCACCTCCTCCCCGACC
CGACAGCCCATTTCCTGGGCCACGCGACCCGCGATCGTCACGGCAGCGACGCGCCGCGGCTGCGTGCACACGATGACCCTGTTTCTCGGGGTTTCTGCAT
TAAATTGGGCCCTTCTCGGCTGAGACGCCGCCCATCCAGCCTCCAGCAGGTACTGCGGCACCTGCGTCGTCTTGCCGGAGCCCGTGGCGCCCACGAGGAT
CGTCGTGGTGTGCGTCTCCACCGCGTAGAGGATCTCCTCGCGGTGTTTGGACACCGGCAGCCGCGCTCTCTGCGCGCGCAGCGAGAGCCCGTGCAGCGGG
TTGAACTGCACCGCCGGCACCTCCGCGTCCTTGGGCAGGTCTCGAGCCGCTTCAGCCTCGGCTCCCGAGCCCTGCAGCGTCGAGCCAGGTCGCCAGAACG
CAGCCATCCTTGCAGATACACTTGCCTTGCAGGTGCAGGTTGCAGTCCGCTGTAACATCACTATTTCGAGGGAGTGACCGATTTTCGCTGTCACTGTTTC
GAGAGAGTGACAGTTTCGAGCGGTTCAGTGACCGGGCTGCGCGTTTTAACCGGTTAACCCTCGTCCTGGAAATCGGGACCGCCGAGGCCGATCGGATGGC
TGGCCTCGGCCTTTCGGCGCCGAAAATCCCAATACGGCAGCACTAGCTATTAAACAGGGAGCGTAGTACAAGTCACCATGGTAAGCCTGCCTGCCTCTAC
ACCAACATGATAGCCTGAGTATGAGCCTCCGGACGCGACGGAGCTGCTACTGCTGCGGGTGCTAGCGCTGGTGCATTCAATTCCGACGTGGCGGCGGCAA
TGCAGCGCAAAGGAAGCGGAGGATTGGACGAACGGAGCGAACAATAAATACAGGGACAACACAGGATCAATGCACTCAGGCGCCAATACAGCAGCAGCAG
CTCCAGCTCCAGCTCCAGCTCAATGGGCAGACAGCGACCAATACCACTACAGGCTTCATTCTGTAGATGGAGAGCAGTATGAAGAAGATGGTGCATTGGT
GCTAACGCCTTGTTCGCGTTTGTGTTGCTGATGCCGCCGTGCAGCCGCCGAAGACTCAGCAGAAGACCAAGGAGCAGAAGATGGCCGCCGCCATGGCCGG
TGGCAAGGGCAAGGGCAAGAAGAAATGGTCCAAGGGCAAGGTCCGCGAGAAAGTCGCCAACAAGGTTCTGTACGACCAGGAGACGTACGAGCGCCTGCTG
GTGGAGGTCCCCAAGATGAAGCTGATCACCGCCTCGGCCATCGTGGAGCGCCTCAAGGTGAACGCCGCGCTTGCCCGCGCCTCGATCCACGAGCTGGAGG
AGAACGGCACCATCTCGAAGGTGCTGGCCCACCACGCTCAGCTCATCTACACTCGCGCTGTTGCCGCCGAGGAGTAAGAAGTTGCTCAAGTTCGATGATG
GCCGCCACATTGAAAGCTCCGATTGCCCGCCAACTGCCTCTTCTAGGGGGGAAACGTCGTTGAAGAATGGATCTACGCGATTGCTGCTCGATGGCGAGGA
CAGGCGAGCGGAGCAGGCACAATGTGTCCCGTGTGGCGAAAACACCGCGCTCCTAGTAGTAGAGTGAGGACGTGGCTCCTTTGCCGTCTCCTGTCGTCGT
GGTAACCCCGCAGCAAAAGAGCGAAAATGGAACACGTCCCTCCCTGTTTAACTTACTGGTCCTCCTCTATCGGCTCTGTGCGTCTTCCCATCCATTGCGT
TGCTGTGTGTGTGTGCCTGTTGTAGTGCTACTTGTCAAAGAGGTTCGCGAAGGCGTTCTGCTGCTTCTTGCGGAGCTGCGTCCTGGCTGCTTGAGCGCGC
GTCAACGCAGATCGGAACAACTTGTTGTCCGGCTCAAGCTCGCGCAGCTTGGTGAGATCAGCCACCGCTAGTTCAAACTCCTTGGACGACACATAAGCCT
GACTGCGACGGTAGCGAGCCTTAACGTGCGAGGCATCCAGGTCCAGCGCGCTCGACGCCGCAGCGATGCAGCGATCCACGTCTCCGTCGCCGTCCAGCTT
CGAATAGCATGTAGCCATGTTGGCGTAGCACGCGACAGCCACAGGGTTCACGAGCTGCAGCTCCTCCACCGAGTACTCGACCTTCGCGTCCAGAGTGGCG
TCCGACCGCAAGATCGGCGGCTCGAGCCACGCCAACGCTCGCTTGTAGAGCCGCACGGCCGCGCTGTAGTGCTCCTGCTTGAAGGCCTCGTTCCCGCGCG
CTCGGTACTCCCCCGCCCGCGCCAACTTCCACGAGAACCATCCACCTTCCTGTTCGCTTACTGCAGTCTCCGCTTCAGGCTGCACGTCCAGCTCCAGCTT
GCAAAAAAGCATAGTCTTGGCCTCCAACCCCAATTCTGCAGCCCTGGAGCCTAAAGTGAGATCTCCCACGGCGACGGGGACCGCGTCGTTGCCTAAGTAC
ATTGAAGCTTCATTGCTGTCACTCCTGACACCTTGTTCCCGGTCCAGAAGGCACTGCAGACGCTGCTGGAGCTCCGGAACGAGCTGAATCCCAGTCGAAT
CCAGCGCGAAAAGCGTCGAGTTTGCAGCGCTGTCAGGAGAGTTCGGGAGCGTTTGAGGCTGCGCACACCGCACCTGATCAACAGGGAGGCTTCCGCTCAA
CAAACAAGCTGTCTCCGAGCACGCCGCGTCTCGGTAGAGCGACCAACGGATGCATCCAGCGCCGCGATCCGTGGTCATCTTCGGTGGTGATTTGCTAAAT
AGAGTGTAACCTCAATGTATCCATTCACGTAACCATTAGCAAGTATCTACGAGCGCTATACCAGCCAAGACGCAGCGAGCGCTAGCGCCGTTATAGCTAC
ACTAAGTGATGCACGAGAGCTCACACATGGATACAGATGGTCCCATTCGTAGCGCAGGCAGTTGAAGTCTTCGAGCTGGCAGCCCCAGTGGCCGCATTCG
CTCAGATGGGTACACAGCAGGCGAGCGGAGCTCTCGAGGCAGAAGTCGTGCCTCACGAACGTGTCAGCAGACACCTCAGTGCACGTACAGCGCGATAGAG
ACAGTGCCTTCCTGTGCAGTTCGTCGCTACGGAGACACTCGTCCGAGCACATGGCCGAGAAGAGATCCGCCTGCGGCACGGGTCCGTACCACCCAGCTCG
AGCGTTCTTGAGGTACACGATACGCGACTCGCACATTGTAGCCTGGATGAAGATGTCTTGGCCGTCCTCGGACTCGATGAAGTTGTTGTAGATGTCCAGG
TCGCACCCCAGTCCTTCTACCAGCCGTCGAGTTGCTGCATCGCTGGCGTTGGACGACGCCATCGACAGCGCCGTCACGTTTGAAGCCGCAGCCATTGCGT
GAAGCGGTAGCGAGGCTTGGATTGTACAGCATAACCATACTAATAAAAGGGAACACCTTACTGCTGTACGTGTACCAAGCAATGTTTCTCCCATGTCGTT
CGTGCTAGACGTGCGCGATCCTGATGCCCGTTGCGTCGTTTCGCCTAAGTTCGCTTTAGATTCGTGTTAAGTGCGAGGTCACATTGGCGTTGGTGGTCAT
CGCCAGGATGGAGGAGTTCCTGCTGCACCACTGCGTCACGTCGGACGCGCCCAAGTCCGGGGACGATGCCGAATCTCAAGCTTCGCCTTCAATCTGGCGG
TCCTCGGGGCGAGCGGAGTGCGTCCTGGTGCAAGAAAACCGCCACGCGCATGGCGCGTCTCGTGTGATCCTGTCGGCCATGCTGAAGCTCTTGCTGCAGT
CCGCCAAGACGTCCAACGTGCTGCTGCTGACGCTGGTACGGCGTACGAAGTCTCCGTGGCTGGTGTTGCAAGCAAGTAGAATGGTGCTGACTGTTGTTAT
ACCGATGAATTGCTTTGTATTAACGGCGTGCAGGATTCGCCTCACGTGGCTCAAGGAGTTGAAGCCTCAAACAAGTTCACGCACGTCGACTACTCTGCCG
ACGCTAGCAACTTCCAGTCGTCCATTGCAGGCTCTCAACTAGTATCTACATTGATGCGTGATATTGAGAGTGTTGAAGCGAAAGTCCGCCTGAAGGGAGC
GACCTCTGCACGGCCGATGGTCGTGGTGCTGGACTCGCTGAACGTGCTGTTGCAGCAGACGTCACTGCAACAAGTGCTGCTGTTTCTGCGTCAACTGCGC
AGCCACGCGGTCATTGGGT