Description :
From Genome Similarity Track
Location :
Scaffold_355:5725- 8654
Transcript NameFunction/comments
Phyag_g4970conserved hypothetical protein
Phyag_g4971hypothetical protein PHYSODRAFT_490853

Sequence
2929 bases(100 bases per row)
TCTTCGTCACAGGAGCAGAACGGGAGCGGCTCGGGCTCGCTCTCCGTCTCCGAGTAGGTGCCTGTGGAGTCATGGTACTTGCGTCCAGAGGACCCGCCTG
CGGGCGAGCCGTAGCTGTACGCCGTCTTGCCCATGTCAAGATGCGGGGACCGGAACGAGGCCGTCTGCTGTAAATAAGGCTGCATCCAGAGGCTACAGCG
CagacgagagcgaggagaGAATAAATCGAAGTGATCGCGCCTGGAGGCAGGCAAGGGCAGGCTgcgcgtgttgctgcagcaacgatTGAAGTCCGTCGGG
CACTCACGTAGATACGCGGGCGTCACGTGCGGCTTTTTTGTGGTCTCCTTTCTCATTGGCAGCCGGTAAAGTTCAGAATCAAGTACAGTGAAGGAGATAT
CCTCGTGAGGACAGCATCGGTCTATTGCAGCTGAGGAGATCGGTCGTTTCCGACGGGAATACGGTGCTCAACAAGGACTATATTTCGGCTTCGCAAAGGT
ATTGCGGGCCGTCGTGCGTCGCCGACGTACCTATCATCCAGGTGGCAAAAGGGTCGAGCCACCGCGGCGGCGTGGCAGCCTGCTCACTGTCTGGCAACTT
CCGCCGTTTGcagcaaagctgcagcagtctgCCAGCCAACCAAGCCATCCAGCACCCCGAAATGGTCAGAGACCCAAGGGACATGCCCAGAGCATCACCG
TTGACCGGATACGTTGGCGTAGCGTGCTTCCCAACAAATGCCAGCGATCAAGTCGACAAAACGTGTGGCTATCGATACCCATGTTTTGTCGACTCGACAT
TATCAATACACGTTTTGTCGATCCCCACGCTGCTATATGCATGTTCTGTCCGCTCGATCGCAGCTATACGCTCCGATTTCGTCAGCGCGTATCCGCGCGT
GTCTCTTGCACATGCTGATCCCGTTAAAATGCGACTCTTACCGATATACGATGTACAGATGTGCCTCCAGATAAGCGAGTGGTCGACCATGCAGCGATTT
CAAAGGGATTAAATGTAGTAAAAATATTGAACATCGTAAATCACTCCAAACACATAACTAATTTGACGGGTTATTAGAAGTATGAGGTTGCGCTTTTCGG
GAGGAAAATCTGTATATCGCGTGGCAAAATGGGAGAAACGCAATAATAACCTCTGAATAACACAATAAACGGATGGGCGACATCAATCGATTTGTCGACT
CTATGAGAACACCCGCCCAGTCCAGACTGTGCACCCAGGATGCTAACCATGCGTTCCCGCTGCGTCACGGCGTGGCAGGGGCAGAGAACCCCCCGCCAAA
GCCGAAAGCGTGAGGGCAATACACTAGGCAGGAGGTTCTATCTTTATATCGCGAGCGTAGCGCGGCTGGTCACTCGCGTCCTTGGACACTGCCAACTGAT
CTGTGACAGTAGCGTTTGTGGAATTCAGGCGGATTTGTAGATGTATTCCCTTCATACAAAAATATAGGAAGTGATATCCCGTCACGACGACTTTTTGCCG
CTGCGACCGACATTgcaagcagcgctggcacTCCTGGTTATACCCTGACCGGCGTGCTCTCTGAGCTTTCTCGGTGTGTGTAAGGTACCGCAGGCAGCGT
CGGGCCGATGGTCTCTACAGTGTACACATAGGACCGTCGGAACtgcgcttcaacgtcgacgaatGGACCATCCACGGAGTATAGCAGTGCTCGCCATGAG
CAGGTCTGGTGGAATGCGGCAGTGCATTGGGTCGGGAGCACGTCGCTGGTTCTGGTAAGCAAAACCGTTTTAAACAGCGTACGCTGCTGTCATCTCAGGA
TGAAGAACCTCCATTACTGTATTGGAGATAGCAGCGGCCCTCGACTTGTAGTTGAGTAGGACAACTTGCCATTCGCAATGGCGATTCGCCAAGCCTCGGC
AACACGCACTGAGGCGTATTTGCACATGTAGTATCGGCGTCATTGCCAATTGCCAATGACtcattgctgcagctgaacgcGTCAGGTGCTTCAACGTAGC
AGAAATCAGGCTGTTTTCGCGTGTATTACTGGTCCGATCTCAGCCTCGCCAGGCGAAACACTGTGCTTATCAGAGCAGCATGAGACACCTGCAGCATTAA
ACACAAGTGCAACCACGGCGCGCTCATGTGCTAGTGCACCAAGGCATCCAAGTGTGATACCGTACTGCGTCAATCGTGCAACAAGAGTCTAAATGAGTCC
GTTTTACCTCATTCTGTAGCATTTTAGCTAAACCTGGTACAGTGTGCCCATAGATCTTAGGGAAACTCCCTCCCACCAACGAACCTccttcttcaacgtc
gcgCCATACTCTCTCGGTCTCCGCGACAGCCAAGATCGTCAACTCCATCACGGCTCATCGCAACCTCGCTTTAGCCTTTCGCTTCGGGtttcaccagcag
cagcagcggcctcCGATCGAAATTCGTTCTCCGGCGTCCAGTCTACGCCAACTGTGGTGTGTCCAGCTGCCTTATTAAGGGCGCTCAGCaagctctctct
ctctctctcttcgcTGGTTATCGTCGCACAGTTCCACCTGCCGCGGTGCCAGCAAGAGCGCGCGAgacgcagccagcgactGAGCAGCACCATTGGCCAG
GCCTTCTTCTGTCTGCAGACGCGGCCGCAGCCGGTGGCCCCTTACGCTCCCGCTCAAGTGCTGAGCTTCCACGCGCCCGGCGCCCCCGACGACGTCCGCG
AGCGGCTCGCGCGTCTGCTGAGTCTTTCCACAGCTACAAACATGATGGCCGATCCAGACATCCATGCcgccaaggagcagcagagactGCGGCCACGCGG
CGACAGTgccagcgacggcgacgtaGCGGAGACCGTCGACGCCTTTGGCGCCGCTGACGAggtcgatgacgacgacccgcAGCAACAGGCGGTGCAGTCA
CTGCCCTACGTCAAGTGCCGCGAGAGCGT