Description :
From Genome Similarity Track
Location :
Scaffold_89:57242- 62124
Sequence
4882 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCCGGTTTCTTCTTTCTAGGATGTTGCCCGCTAGGCATGCATCCATGTCCCGGTCCACTCGACTTATTCGAGTGGTGGA
CCTTTGGTGCTGCCTGTACTTCTTTACAGTCGCCGGGAGCTTGCTCCACAGTGTAGGGATCAGCTACACTGAGGTCTTGTGCAGTCGTGCTAACGACCGT
ATCGCAAGTGAGGCCATCGCACTCACTCGCAGTACATCCACACGCTTGTGGACGATCTATAACGTTCATCAGATGTCCATCTGATGAACAAGCGGCAGGC
ATGTTCACGGATCGATGCTGCCAGCTCACTCTTGGCTCGTATCTTCTGAGCCAAGGTAATCCCAGGATGATATCAAATTGGTCATCCAGATCCAGTACGA
TGAAATCATCATCGTACTGTTCACCCTCTGACGTGTAGTGGATTCCAACTACACGTTTCGCAACGGTTATCGACGCACCTGTAGCAAGGAACACCGTCAT
CATCGTTTGAGGGATGTCGCGCTCAACGAACTTGAGCCTACGACCCTCTATCGACTGACGACGAACAAAGTTGTTCGACGCCCCACAGTTGACTAGAGCA
CGAAGTGACAATTCATTTTTCACTTGCAACTTCAAGGTGATGAGTGATATCTCATCACCAGGTGCAGAGACACACAATGATTGTGTATCTGGAGCAACAT
TCGTCATGAGATTTGCAAATTCTCTTGAGGTTGCTGGATCAGTAGGGCGATCCGCCTCTACTGACCCTGACCATTTTTTATGGTCCGCTTCGCTGTTGCG
GTTTCGCAACAGCGTTGGACCTACGCCGTTTGCCCTCTTGGCAAATAGCCAATCATTTCTCTCTGTACTGTTTGGTACTGAGCGTGGGGCACTACTCTTA
AGCGTAGTGCCCAAACTTCTGGCAGCGGTTGCACTTCTGGAATCGCTTGTTGTTTAAAGAGCGAGATCTCTCGCTCTCAACATAACAGAGGTCCATTGGT
TCTGAACCTCCAGTCTCTTGTCGTCTCGGTGGACGATAAGAGCTCGAGCTAGCATGAGCCTGCCTCATGCTAAAGTCCTCCTGTTCCGCAGCTGAGATTG
CTTGTTCAAGCGTACCCAACTCTAAGCGGAACAGGTGGTTCCTGATGGGCCCATTTACGAGCCCTTGCATGAACACAGTAATCAATGTGTGTTCATGGAC
TGGGTTAGCAATTATACTACTCGCGAGGAGTCGTATATGCTGAGCGTAAGCGTGCACATCACGCTTACCGTGCTTGAGTTTCAGAAGCTCTGACTGAGCC
CTTAACTCAGCTCTTGGCGGCTCAAACAGACGTTTGAGCCGGGTTTTAAAGGCTTCCAGCGACCCAAAAGCATATGGGTCGCTCTTCTCCAGCCCTAAAG
CCCAAGTCTTGGCACGCCCCGCCAAGTGGGTTAGAGCAAATGTGAGTTTATTTACTCATCGTCGATACGTCGTGCCTTTATGGCTCTGTCTAATTCGACG
AACCATAAAAACAGGGAGTCTTCCTCGACTCCTCTGTACTTGGAGATATCAACCTTAAAGATTTCGGGACGACACGTATGTGTCTTCCCGCCCACTGCAG
CATCGAATTACTGCTGTCTCAACAGCTCTGTCTGTTGAGCACCGAGTTCCCTCAACTGCTCGGCCTGTTGAGAGCCTTGCTGGTGAAGCAAGGCTACTTT
CTCTCTTTCGGAGACAAGTTCATTTTGAATGAATCTGGCTATAGCGGCATGTTGTTGGTCTCTGTCAAGAGACTCTAACATGACGCTAGTGGCGGTTTCT
CCTAAGGTAGAACTCATACGTTCTACCGCACCCCATTCGATGTCACTTAAATGGGTATAGTCTTCATGCGTGGCGTGAAGACTCTCCTCCTCATCCAACA
TGTTCATGTCAGATGAGGTGGTTGTGGTCGCTGGAAGGACTACAAAGTGCTTCCAGGTGTAACGGGGCACGCCCTTACCAGATGACTGGTAAGACCTTGT
GTTGCCTGAACACAAGGCTGTGTACTCCCGACTTCACGTACACATGGCGTGAGGAAGCGCAGCGAAGTAAACAGAACTAAAAGCTCTGTCTAGGAAAAAG
TCGAAGTGTATTTAATATAGTTAAGATTTCTTTGTTAATCATCGTTGTCTTGATCTAACTATATTAAAATACAATCTCCTATGTGGTTTTCTTGCTCACC
ACCCATTGCGCGCGTCCAGCAGCGATTGATGGTTAATTAGGTTGATGTAGTGTCTACATCAACCTAATTAACCATCAATCGC