Description :
From Genome Similarity Track
Location :
Scaffold_1:57237- 70434
Transcript NameFunction/comments
g15.t1XP_024573396.1 Transcription factor IIB [Plasmopara halstedii
g16.t1KUF69639.1 Phosphomevalonate kinase [Phytophthora nicotianae
g17.t1hypothetical protein
g18.t1hypothetical protein
g19.t1XP_009515381.1 hypothetical protein PHYSODRAFT_554382 [Phytophthora sojae
g20.t1RAW36034.1 U4/U6.U5 tri-snRNP-associated protein 2 [Phytophthora cactorum

Sequence
13197 bases(100 bases per row)
CAACGGCAGCGTTCTCCTGCCCGAGTACCGGTCATACTTACGGAGTCGGGGACAAAGCTGACAGATTTCTACTTGCCGAAGCTTACCGAGCTGTTGATTG
ACCGCGAGACCCGAGCTGCTGCCACAGCACATAAATCATGGGATGAGGCCCACAAAATCGAAGTTCTCGTTGGTGGCAAGTGCGTCGGCCGTATGAGCGC
CGCCTCGCGGAATATTCCGCCATCGATTCGTTCACGCCTTCGAGCCTCTGCGAATGTGTCAGTGCGACGAGAACGGTTGTACGAGTTACTTCGTAAAGAT
TATGATGAACTCAGCAAGCGCTGCACGCAGTAAATGACGCACCGAGAAACGGAACACTTCGACACAGTTGAGGGAGGTTGGTCATTGCATTGGAAAGAAC
GCATCGTCTGTCAGACCTTCGAAGATATTCACGTTGCTGTCGCCGTACAGTGCTGAGTCTGGCGACATGCTCATGGATCCCGCCCCCGTTTGCTGTGGTG
GATGCTGAGGAAGCTGGTTATGTTGGTGGAAAGGTTGAAGTCCACTTGGCACTGGCTGATACTGCTGCGTTGGCATCGGCTGCTGCATAATACTCTGTGA
CGACGTTGTTGAACCAGTCGGCATCCCGACTCCAGCCCCATATCCAAAATTGTTGTTCATCATCATCGGTGCTTGAGCTACGAAATTACCCCCATTCATG
GGCATCACGTGTTGCTGCTGCGCAGGCATTCCAGTCATACCAACCATGGGAAAACTTGGTGCGCCGAAGTTTGCATCAGGGCCAAATCCAAGCGGTGTGA
TGAACGGGTCCACCGGGAAGTTGCTAGTGATATTATTACTGCTGTCATTCCCAGTATTGGAGTTGCTCGTTGATGTTTGCGCCGAGTTCATCCCAAAATT
GTTGTCGCCATACATATTCCCACCATCAGATGAAACCAAGTTCATAGGCATAGCCATAGGCACGAATTGTTGCTGATGAGGGTTCATCATGCCGCCGCCC
ATCATGAAGTTCTGCTGATTCATATATGCAGCGGACGAGCTGGGCGCCCCACTGGTAGAGGCCATGTACGCGTTTGGCGTGAATGCCTGCACTCCTGACG
TCATTGCATATCCTTGAGTTGACGTTGTTGCACTAGATACGGCCATCGATGAGGTGGCAGTGAATCCCGCCGAGGCTTGCATCGGATTCATCTGCCCTGT
TGGGAAAAACATACTGGAACTCGTCGGCGTAAATCCAACCGTCGGCATCAGAGGCTCAGGGAATGGCATCGGTGCCGACATATTGGGCATTGCTATTGGC
GCCGAGCCCGACGCCAACGACGCAGGTGCAGATCCCATGGATGCCGACGTCGTCATCGTCATCAGATTGTTATCCATCGTCGAAACCTGCGGCGGTGCGT
AAACTTGTTGAGACACAGCAGGCGTCTGCTGGCGTGGCGCCTGCAGTGCAGCAGTCGTCGGAGCTGAAAGTGTCGAGTTGGATGGTGTCGCTGCCAGTCT
CGCCCCAGCTGAGGAAGGAGAGACTCTCTGCCCCCCCGTCTTCTCATCTTCCTGGGCAATCTGCTTGTCCGCCAGCGATGCCAGCACCTCCAGCCTCGTT
CCAATCTGCTGGCGGTAGGCTAGACACCTCCGCACCCACTCCTTATGCTCCATAGGATTCGTCTTGGAAGCTGCCAGCCACAACAATCAATAAAATACAG
CACAAATAAGATTAGCAAAGAAGAAGAAAAAAACTAACTAGCATCCTGTTCCGGTGCTAAAAGGTGACGTACGCTGCTGCTTATGGAGTGCGTTCCACGT
CCTCAGCGCCGCCTCGTTCTTCTCCAGCATGGCCTGGATCTCCACCTGCGACACTTTCCGCTCTGGAGCCAGCAGTGCCTGCATCCGAATAAGAGAATCA
TAAAATATCGTTAGTATTATGTTTAACATACATATTTTAGCGGCTATTGCGCTCCTCGCTGGCTATTGCGCTCCTCGTACCTGCGCCGCGGCGGCCGCGC
GCTGCTGCAACGGGTTAAAGTGCTCCCTGTTGGACGCAAGAGACGCAGAGAGCGCGTGAGAGGCCGGAGGAGCGCCCGGGGCGTGCGACGAGGGCGCGTA
CGGCGCCGAGGACGATGCCATCTCGGAGGACGTGAAGGATTGGCCAGTGGACTCAGCCAACGGAATAAAAAGTCTGAAAGATAGGTTTATGTTTTCAACC
AATCAGATATCTTTCACAAGATGCTGACGTACGTCAGGCTCACTTAGCGATTTGGCGACTATGCTGCGCCCCACGTGTGTGTCTGCGCCCGGCAAAGTGC
TGTTAGTGGGCGGATACCTGGTGCTGGACGAGCAATTCTCGGGGCTGGTGCTGTCCAGCACCGCGAGATTTTACTCGCAAGTGGGGGTTAAGGTGCGATT
GTTATTGGACTGTGCACAAAATGTGGCAATTTGGAGTTTGACCATTTGTGTTATGCTGTGACTATTGCAGTCGTTTGTGGACAATGATGGGGGGTCTGCT
GCCTCTGGAGACTGGCATCGAGTGTTCCCGTTGACGGTGGAGAGTAAACAGTTCGACCAGTTGATTGACGGCTGGATCGAGGAACACGGCGACGGACGTT
TCCGGTTCCAGCTGAAGGAGGGCTCGCACCGGAATTCCTACATTGAGGAGACGGTGCTGTGTGCTGTCAACGGCATTGCAGGATTGGACGAGTTTAAGAA
CAGCAACACGTTTCAGCAGCTAGTAGAAACGAAGATGGCGGTTCATGTTGCGCTTCGCGGTGACAACGACTTTTACTCGCAAGTGCAGAGGGTGAGGAAT
GACGTTAGAGGTAGAGTGCTTTGGCGGGATGCTGATAGATGAGCTTTGGCGTTTTGCTTGCTCAGTTGACAGAGGCTGAGTTGCCACTACGTCGCGCGAA
TTTGAGAGCTCTTGAATCGTTCCTCCCGCCAACGATGGAAGGTAAGCCTATGGCGGTTTTCGATAAGCTGGCTGACATTCTTTTAGCTGATATATGTGCT
GTGTGTAGAGCGTAATGGCAAGCTAGTCGCGTTGAAGACAGGCATGGGGAGCTCTGCAGCTCTGGTGATGTCGCTTGTTGCAGCGCTTGTAGCGTTTTTC
GTTCCGACCGTGAGATTTGACGAGAGAAGCGAAGATCTCGAACTGGTGCACAACCTAGCTCAGCTAAGCCACTGCTACGTACAACGCAAGGTACTGGCGA
TTTCTTATGTCTACCAATCCCGCGCTAACGAACTGGGGTGTTTACAGATCGGAAGTGGTTTTGATGTATCGGCGGCATGCTTCGGCTCTCAACGGTATAC
TCGGTTTCCAGCCACAATTTTGGATGCGTTCACGACTGAAGATGCACTGAAGTCCGACGACATTGCTCGTTGCATCACAAACCGTGCACTTTGGGACACT
CCAAACCGCGTGGTAATGCTGATCTCCTTCGGAGATCTGGTTGCTCTATATAGTTGTAAGGGTTACTATTCAACACATTCTAACTGGAATCCCTTGTCTT
TGCCGATAGAAATCCGTTCGATTACCTTCAAGTTTTCACCTGATAATGGGAGACGTGTCGTCTGGCTCGGCGACTGTGTCAATGGTTCGTCAAGTGCTGA
AATGGCAAAAGGAGCAGCCCGAGCACGCACGGAGAGTGATGGACGCAATTCACCACCACAATATGGAGGTCGAGCGAGGGTTCGCTGATCTTTGCGAACT
TGAGGACAGCTGTAGCAGCCCCATCGACTGGGAATCGTTGGCGGAAGGACGAGAGCAGGTATGTTCATACCTTCATATATTGGTGTTGTTCTATGCTAAC
CATTATGTTTTCGATGTAGTGGAATGTTGGGGATGCTCGAGTTGGAACCATTCTGTCAAGAATCAACAAAGCGTACTCCAAGTTCCGAGGGCTTATGCGG
TGCGTTCGATAACTCGAGTTACTTGTCCTAGCTGAACTAACTTGTTTTCTTGCTTGCAACTCAACTTTATAGCGAAATGGGAACTTCTGCTGGAGTCCCG
ATAGAGCCACCGGAGCAAACAGCTATTCTCGATGAAACGATGAAGATTCCTGGTGTTTTGGTCGCTGGAGTTCCTGGAGGTACTTCTACCGATCTGATGT
TTTGTTAGCAATGTGTTGACCAGTGACTTGTTGATTTTGTCCACAGCGGGTGGATACGACGCCATTTGCGTGGTGGTGCTTCATGAGCGAGTGCTACAAG
CAGTTGAAGATCTGTGGGTGGAGTGGCCTTCTACGCACCTAGACTCCACGTACGTGTCTCGAAGGAGTATCATTTATCTCATGCGTGTGTTACTCTGACG
TTAACATTTTGTTTTCGTCCGCGTCAAATCAGCATTTGCCCGCTGTTGTGCGATGTCGACCGCGGGCTGACGAGCTCATCAGCACCGACATCGGGGCTTC
AGCTTCACTCCGTTGAGTAGTTTGTGCCCTCAACACTGTCGTTGCAGTGAGGCTTAAACGAACCTTCACCTTTAGAGCGTAGAGTGCAGTTCATCACCAG
AAACCTGCACAAACCGTAAACGAAATCTTGTTCACTTGTCAGGGGTCACACCACTTCAATTTACAAAAGATGCCAAAGCGGAAGATCCGCGACGAGGGTG
GCTGTGAACTAGACAGGGAGGTGAAAGCGAGCTACGCCCGCCATAGCGATGAGAAGGTTAGATGTAGTCATCCAGAGCTGGATGAAAATTGTCTCTTTTC
GATTCCTGGGCTCAGGTACGCAACAGAGTCGTGGGCCGGTATGAAGACCAGCAATGAAGACCGTTATGTGTTCTCGGCCGAGTTCTTCCCTGGCCCGGTG
TTCGGGATTTTCGACGGTCACGGCGGAACGTCTACAGCAGATTTCCTGACCCGACAGCTAGTGAAGACTACTGCCTCAGCGGTGCGCCAGAATATCGGAG
CCAAAGCTGTGAGTGACCTGCAACGTTTACAGGTGCATTCAGGTCAAGAAAGGAGCCGCAAAGATGCCATTGTTGAGCAAGTAGGGCTGTTGCAGCAACA
GCTTGCTGAAGTAGAGGCGATGAACGCAGACTCCACGTCCGAGACCTCAAATGACACTTCTGCTGATGAGCTGCTCGCTCTGGCCGACCAACTTACTGAC
GCTATTTCGCAGATGAACACCGAAATGCAGCAAATTGAGGCTGAAGAAGCAACACGGCGAGGAGAACGACAGGAATGGTTTGATGAACAGCACAACCACT
TCTTGAAATCATTCAAGGACGCCTTCGAGCGCGTGGACTCGCAAATTTTGCTGAAACACTCGTCGCAGGATGGCTCTACGGCTCTACTTGCTTGGTTTCT
AGCCGACTCGACCGGTGATAGCGGCGGCGACGCAAATGCTGAAGCAGGCGAGAGCTCGGCGGGTGGACTGAGTTTCTATACGGTGAACGTAGGTGATTGC
CGTGCAGTAATATGTCGTGGTGGCCGAGCTGTGACGCTCACGAGTGATCACAAGCCAGATCGCCCGGACGAGAAGCAGCGAATCGAAAGAGCTGGCGGCT
TCGTGGGGAAAATAGCAGGCATATCTCGAGTGTATTCTGCGGCAGGCGCTGGGCTGGCCATGCAGCAGGAAGCGTCCACTTATCTGGCCGTGTCGCGTGC
ATTCGGCGACCGATCTCTGAAGGCTCCGACGCCGCTTGTTTCGTGCGAGCCCGAAGTGAAGCGCTTCCAAGTGCAGCACGACGACTTGTTCCTCGTCTTA
GCCTGTGACGGCATCTGGGATGTATTGAGTGAGCAGAACGTGGTGGATATCGTCTTGCCCCACTTCCACGATGCCAAAGCTGCCGCTGATGCCGTCGTGA
AAGCTGCGTACAGGAAAGGAAGCGTTGATAACCTCACTGCTACGGTTGTCCAGTTCGGCTGGAAGTCCGATGTTCAGGTACAGCAAGCCCTAGAGAACAG
CAAGGGGGTCAACTCAAGTACCCCGAGAGGTAGATTTAGCGTTCACGAAGCAGCAGCACAGGTAGATAATGGCTCGGAGGAGGAGATCGACATGTTCAAT
CTGTGAGTAGACGATTTCGCAATCAAGCTGCTGCATTCCTTGGACTACCTTGAACGGAAGTATTAGCTGGGACGATATCCTTGCTCGTACGTGGCGATAA
GGTTCCGTTGTTTGAGAGCCTGAAATGCACATACATGTAGAAGAAAGAGAGTTCACGCGTTGGTAGCACCAACCTAACGCTTAAAACACAAAATACTAGG
CTGGCAGATGTACCTCAGCAACGGAAGTCATCGTATCCGTATCGTACACTCGGAAACGTACTGGAGGAGCAGGCTGCCGATCACTTCGTCTCTGCTTCCG
CTGGTCAAGTGCAAGCTGCTGATCCACGAAGGCCTCAGCTTCTGCTCGAACGCAAGACAAATGAAACTCCAAACAACAGCAGAAAATGCTCGATCGTGCG
TACCCACGCGTGGGATGGCGAACCCTCCATTGATAACCATCGCATGCAGCTTGTTCGCGGCGTTGGGCGGTGGGGAGACCCGGAGCACTCGGTACTTGGT
ATCCAGGTTCTGGTGCAGGAAGCCCACGACCGCCTCAAACTGCGAGAAGCATGACGTCAGCAGCGCCAGACCCAGTTGAAGCCACAGGGGCCGAGTGGTT
GACTCACGTCCTGCTCGATGCCAGCTCCACGTCGCCCGCGCTCGCCTTCCAGCCGCGAGAGGCGATACGTGGCGAACAGAATCGCGACGAGGATCACTGC
ACAGCGTCAGCCCCGCCACCAGGTGGAAATTACAGGCCCACAGACCCACCTAGTGCGTGCTTCCTGACGGCGTCCAGCATGGCGCCGGTTGACGGACGAA
CACTGTTTTGTTCCTGGAAAATCCTGTCTCATGCAACGCTACTCAGGCGCTGTTCTCGCTAATAGCGAGTCTCCTTGCTGGAGAAGATGGCTCAGAGGAG
CAGAGAAGCGGGTCTGGTCGGAGATGAAGCCTCACGGGCAGAACCAGTGCGCGGCCACCACGCGAGGACGCTACAGAGTCTAGGAGGCATTGACGAGGCC
GACTAAAGTAAGATAACTGCTGTACATTAAGGGTGTGGTGTGATAGTAGCTACAAAGTGGTGGCTTCTTCGGGTCGAGGTCCTAATCTTATGCTTTGTCT
GCGTACTGGTCGTCGGCCTTGACGGGCGCTGGGCCGACGAGTGCGCACGTCTTGAGCGCGTGCCTGTCCATGAGCACCTGCGCGACGTTAACGGGTTCTG
TGGGCGGCGCGTCGGTCTGCGGGGTCTCCTGCGCTCGCTGCATCTGCATAGCCCAGTCGGCCGAGTCGAAGCGCTGCAAACGCAGGCACCGCAGCTGCTC
GCGGGGCTCAGCACTGCCCGGCTCCGGTTCCTGTTCCAGGTCTGCGCCGTCCGTGGGCGCGCACTTGCCGCATGTGCAGCCGGTGCACCGACCCGAGGCT
CGTTGCGCCATCTCGTAGTCGGCCGAGTCGAAGCGCTGGCGGTTGTCGCGGTGGCGCTGGATGATGGTGGAGGCCACGGCGTGCGGGCACTCGCCGGGCG
GCTGGTGTTGGTGCTCGGCGGAGGCCTTTTCACTGGCGTTGGCCATTGCTGTGCGGGTGAGCGAAAGGATGAATGACGCTGCTGAAGAGCGACACGGGCG
TAGAGACGCGCTAAGCTGGAAGGTCGCACGAGGATAACTCGTGACGTCGCGGATCAGCACCTCGGGCACGAGGCCGAATTTTTCTCCGAGCGCTTCGCTA
ATGATAAGGCTATGGGCGTCCTCTCGCGACCTCGAGTCGCAGACAGCTGCAGGCTGGACGCATGTTCGCCGAGACCTGAGCATGCGACGTGTGTAGGAAG
GAAGGAATGATTTTTGTGAAACGTTTGATGATCCTCAACGATTGGTGGCGAGGCCTTCGAGGACGTTGACGATACCGGGACGGTTTCGCCGAAGCGCGCG
CGAACGGCACCTGCACTGCTGATGGCGGTGTATCGCAGCGGGTGAAAGTGGCGTCGCCTTCATGAAAAAATTGGTCGTGGAGCAAGTTGCAACCAAGTTC
TCTGCTGTCAAATGGGACTGGCACAAAGGTATCTTCAATCCACCAAAGCGGTGTCCAGGAGGACAAATCAATCATACTTGTGGGTGTCGTCTCTTCTGCA
AGGACCTCGCATCGCTGCGTTGTGTCGGTGTATGCATATGGCAGTTAGTGTGCATACATACGGTACTTGCCGCCGCCGCTCAGAGCTTGTCGACGTACGC
GCCGTCTTCGGTGGACACCTTGACCTTGTTGCCGATCTCTATGAACAGTGGCACCTTCACCACGGCGCCATTCTCCAGCGTCGCGTCCTTGACGCTCAGC
GCCGTGTCGGCCACGCCCTTGGGAGTGGTTTTCTGCCAGATACGACGAAACAGAATATCGTTCAGTCACTGGTACGGCGTTCCGGCCACGAAGAGAAACT
GTACTCACCGTCACCTCCAGCGTCACGTGTTCGGGCATGTTGGCCCACAGCACGTCGCCCTCGATGATCTGCAGCGACAGCGACATGCCCTCCTGCAGAA
ACTCCAGCTGGCGACCGGAAAACAGACCGCGCTCGATCTCCATCTGCCAGCAGCAGCAGTATCATCAACAACAACAAGCGTCAATTTCGATCTTGCAGCA
GCTTCAACTGGAGCAGCACGCCACACCTGCTCGAAGTTGCCGCTGTGCATGATGACCAGGTGGTCTCCATTGTAGTACAGGAACTGGAACGCCTCGTCCG
GGCCCAGCGGCGCCTTGTTTACGGTCTCCGCGGCGCGGAAGCGGCGGTTCATCTTGGCGCCGGTCTTAATCTCCTTCAGCTCCGCCTACAGCACCCGCCC
ATAAGCTAAATTCGACGCAAGAAGCTTCGTTTGAACGCACCTGTACGTACGCCCCGCCCTTGCCGGGCTTCACGTGCTGATTCTTGCCAACGCGGTAGAT
TTTGCCGTCGATATCGAGCGCCATGCCGGCGCGGACTTGGTTGCCTGTTCAGTCGAGCGTAGCGCAGTCAGTTCAAGGATTCCGACGACATAACGGCCAA
GATATGATAGATCTGCGAGTGATGAATAGCATTGTACCATTGATCGTGGCAAAGCGCACTCCATAGCCGCGGGCAGGTGTCGCCGCGCGCGCGATCTGGT
TGATAGCTCGCCGAAGCATCATGTCAGGAAATAAGCGCCTCTCATTTTCGGTGTCTCTGATTGGTCCGATCTGTACTTCCTGGATTCTGACTCATTCTTC
AATTTTGGCTTCATTAATCGCCAAAATGTTCTTGTGGCGCGGTCGACAGCCCCAGGACGCGATCCAGAAGGCGATCGAGGCAGCCGTGGCGGCGGACAAA
GCGGGGAAGTATCAGGAGGCGGTGGGCCTGTACGCGTCGGGAATCGAGAAAATGATGGCGCAGCTGGCGCGTATGTTGAAGCCGTTAGAAGCTGCTCTTG
TGTGTCTTTCTGAGGTGTTTTGAGTGATTTTATCCGACTGCAGATCTGCAGGACGAGGAATCCAAGACGCGCATGCGGCGGAAGATCAACGAGTACATGC
AGAGGGCCGAGTACCTCAAGGACTGGACGGCGGAACAAGCGCGCAAGCAGCAGACGCAGGTTGGCGGCGAGACTGGAAGGAGATTCCACCAAGGGGGAAG
CTTCTGATTGTGTTTTTTTGTTATGTTGCTGGATATAGGATGCACCGCCGTCAGCTGAACAGGAGGGACGCACTGCAAGTGACCGGCAGGTTTAGAAAGT
TATACATGACAAGTTGCAGCTGAAGTTTTTTTCGTTGCTGACGTTCGTTGTTGTTGACTTTTTGCAGCAACTGAGAGCGGGGTACTCGAAACAGCATGCG
GAGCATGCACATACCATTTTAGACGAGGTGATGGACCACTCACCAGGAGTGCATTGGACGGATATTGCTGGGCTGGACGTTGCAAAGCAGATTTTGCAGG
TTTGGCAACAGGGATTGCATGTCCTATTTGATCTGTGTTATGGTGTTAAGCATGGACGTGGTGTGAGGTAGGAAGCTGTCATTTTGCCGACGTTGCGTCC
CGACTTATTCACGGGCTTGCGAGCTCCGCCTCGTGGAGTACTGCTCTTTGGACCTCCAGGCACAGGTATGTGCTTGTCGTGTTTTGCACGTGATACGAAC
TGCTTTCACTTCTTGCCTTGATGTTGCTAGGAAAAACGTTGCTGGCGAAGGCTGTCGCTACAGAGGCGAATGCAACATTCTTCAAGTATGCAGCTACGTA
TTGACTGTTGACCGATATGCGTTGCTGACGGATGCTGTTGTAGTATTTCCGCGTCATCACTGACGTCCAAGTGGGTGGGAGAAGGTGAAAAGCTAGTGCG
AGCGCTTTTTGAGATGGCTCGGGAGCTCCAGCCTTCTGTAGTTTTTATGGACGAAATCGACGCTTTGCTGTCGACAAGGTCAGCGTCTGAAAACGATGCA
AGTCGCAGAATTAAGAACCAGGTACAGCCCCAGCGCCACACCATTTGCAGTGCAATATGCTGACATATTCTACTGTAACTGCCAATGCAGTTTTTCACTG
AGCTTGACGGAGCAGCATCGTCCCAGGAGGATCGAATCCTTGTCATGGGAGCAACGAATCTCCCTCAGGAACTCGACGAAGCTATCGTACGACGCCTGGA
GAAGCGCATTTACGGTACGCAGTGTCTGCCTTTCCGCAGTGGGAACCCGTGTATTGCCCTCACAGGCGTTTAACATGCTTTTGATGAACCATCACCTCAG
TGCCCCTCCCGGATTCTACTTCTCGGGAAGGACTTATCCGGCGCTTGCTTAGTAGCCAGAAATTCTCCTTGTCGTCAAAGGATGTCAAGCACATCGTCAA
GGCGACTGACCGTTACTCTGGCAGTGATCTCAAGGCTGTGTGCAAGGATGCCGCGTTAGGTCCCATTCGCGAGCTGGGGGCAAAAGTTGCTGACGTAAAA
ACCGAGGATGTGCGCGAGATCAACGCATCTGACTTCCAGGTGGCACTCACACGAGTCCGACCAAGTGTGTCCTCGACAACAATAGAGGCTTTGGTCGCGT
GGAACGAACAATACGGAGTGTCCGCAGTATGACGAGTGTACCATGGTAGATGAGTGCGCTCGCTGGTATATTTTCAGGAATGCTTACGCCTTCCGCTCGT
AGATCATCAAGTACGACTCGGACACACCGATAAGCTGCGGCATCGTTTCCTGGACGTGCAAATCTTGGATTTCGTACCACTGCTCGGTTGCCTGACGCAC
ACCATGTAATACATCAGCACGGATAATGTCATTCCTTCCAGCACGATTGAGTGACGTACTCTATTCTGAACGTGGACACGATAACTTCCTTCTGTCAGGG
GATTCGTCTTGAGCGCTGCTTCTTGGCCAGTTGTCACTGGGCTGTCGTGGCAGATATTCGCAACCAAGTTGTATCTACAGACAACAACATGCCAATGCGT
AAGTGACCTGTGTCACAAGCTACCGCAAACTACATAGTAATTGGCACGCACTTGGTAGATGGAAGCACGACACGCAAAATCTTCTCAACCACGTCAGCCT
TCTCAACACAATCCTGTTATCGCAAAGCATGGCATCAACAGAGCACATTTAGATCGCTGTTTTTCGTCTTGTACCGAAATCGATGTCATGACAGAATCGC
ACCTCCGTTGACTGTTTATGTTGGCGCAGAAGAGCTCGTAGCTCGGAGATTGACCTGAGAAGAGCGTCGAGAACGGGCGAGAGTTAGCGACTATATCCTG
CCAAAAAGGTTGTATGTTGAAACGTACTTGCTGCGAAGATCTTCCTCTGACGGAAGGCTCTGGTCCAGCTTCAAGTAGTCTCGCAGCTCGAGATTCTTCA
CTGGGAAATTTACGATTGTCGGGTTCTTCTCTATGAAAAAGTTGTTCCGTGTGAAACGCTTTACGTGGAAGATCAGGTACGCTGGCAGCGAGTCGATCCG
GTACGTCTTTTTCAGGCGATGAGATCCCTGGAGCACGTGAGTGACATGGGAGCCATTGTACTTCTCAAGCACCGTGAACAGCGGGATCTACTCCAACACA
CCATCTTGCGCGTTAGTTTCAGAAGTCCAGCAAAACAATATCTACAGATTCCTTACTTGAGGAATGATGTTTCCACCTTGAGAGTCCTTGAACAACGGTG
TCGGCGGTAAGTCCAATGCCATCATCCTAAAAACACAGCAGTATGAAAGTCAATATCAAACGCTCATATGCAACATGCGCTGCCAACTTACAAACACGGC
GACACAGTGGTCGTGACAGCTGATTCGCGCTCCGCTAGATCCACCGATGCAGCTTTCGTTTCATCGTCCGTTGTCACTTCCACGAAACCCTGGAAACACT
TGTGGATGATACTGCTCCCTGGTTTGTGTGATCCGCCGAGACCCTACAAGCACAGCATACCGTGTTGTGCCATTAGTCGAATCCCCCCCCCTCCTCCCCA
CTCAGTCTGGAGCTTACCCTATGTAGCTCGTTCAGTAGCCATGCCAGCAGTTCTACACTCTCGTTCTGCGTTCCGACGTGAAACCTTTTCTTGCTGCTCA
CCGAAATCTCCTGCACCAGCTCATGCGGACTGATCTACACCACCACAGTCAACACGTATCCAACTACAACATCTCCCCATTACCCCATCACGCACCGTGT
TCTTGAAGTTGTGTGGGCTCCACATTTTGCGCAGCAGCTCTCCGAAGCGCAACACCAGCTTGGACTTGACCTTGCCCACCTTGTCGGCCAGGAAGAAGTC
TCGCAGCGGCGGTACGTGGGCCAGCGCCTGCACCACCACGTTGATGTAATCCGTGTGCTTGAGGTTGTTGAGGCCGATGAAACCTGGTAGGTAGGACACG
CCGAAGGCGTCCTGCGCCAGGATGCGGTTCTGGTCGAGCCTGGCGACCTGCGCGGCCTCGAACGTCGGGCGCAGCGCGTCCTGCACAGGCTTGAGCGTGT
TGTCCACTACCTCGTAGTTGTCCGGCAGGCAGTAGATGCGGTCCGTCTGGAGGTTGATGAACACGTGGTGGCTGCTCTGCACTGAGTGCGTGAAGGCGTG
CGTGTTGCGGCCGCGGCCCTTGAAGTACTTGCCGCACACGAGGCAAGCGTAGACGTTCTGGTCTGAGAGGCTCACGGAGCAAACCTTCTCGAAGTCGAAG
TCCAGCAGCTGCGGGTGGATAGTGTCCAGGTAGGGACACTTGCGGCGCTTGGCGGCGGCGGCGGCGCCGTCGGCATCGGCATCGGCCTTGCGCTTGG