Description :
From Genome Similarity Track
Location :
Scaffold_24:572346- 579329
Sequence
6983 bases(100 bases per row)
ACTTCCTCTAGTGCAAGGTGCTGTGTGACCCCGTTACCCTTGATAGCACTCGTAATCAATCCACGCCAAAGCTGGTAGACTACCTGAACCTCTCTAAGAT
TTGTTGCCTTGGATATGAACAACATTATCCATCCGAACGGCTCACAGTTCGAGTTGGTTCAGAAGATGGCAGGTATCTTCGGGATGGAGGCCCTGCAGAG
CCTGGTAGTGTCAACACCGGCCGCGCAGCTCGTGCGCGTCAATGCGTTTGACGCTTACGAGCATGGGCTCATCGCGCATGTGCGTGAGAACCTGCAGGCT
CCGGCGGTGGAAGCGAATCCACCTCACCCGAAGCCAATTCGGCTGAAGGTTAAACTGTTTGAAGGGAAGGAAGGCGTGAGCCTTCACTTCTGGGTCCGAG
AAGTATAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTTCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGCCGTGCTAAGCGTTGCGTGTA
CACACGGGAGGCAACATCCCCTGGATGCTTCACATCCTGGGCTCAGCTGTGTGAACAGCTTCGAGCCGCGTTCCTCCCGGCGAACTACGCGTACCGCCAA
CGCTGCGCTTCCTCTCGTGCAAGCAAGGAGGCGTGATCTGCACGAGTACGTGCAAGAGATACGGGAACTCATGGCGTCCCTAGTGGGAAACCCAGTCAAC
AAACACATCAAGATGACTGTGTTCATGGACGGCCTTTGAGTGGGACCCGCACGTACTCAGCTGCCCGGGTGCAGTCAAACACCCTTGAAGAGGCGATTTA
AGTGACTCTTCAGGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCGGCGTGGCCTGCGGGCTACTTGTTGACTCCCGGTCGAACGAGCCCCAAC
GGACCAGTTCCCATTGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGCGGGAAGATGGGCCACTTCAAGTGCGACTGTCCCGCGGAA
AGGCTCTGCAGACGGTCTTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCTCGGGGACAGGGGAACGCCGGAAACCAGTAGTGGCGGG
GCGCCCTACTAGGGAAGGGCTAAGTCGTCTTGATGGGTGCGCGGGCGGCGCGTACCACGACTACTTAGTCCCTGAGAGTATTCGCACCCTCGAATCGGTG
AAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGAGGATACGATCATCCCTTTACAATCTTGATCGATTCTGGGGCATCGAAGAATTTCGCAC
GCCGCCAGACAGTTGCTCGTAATAGCAACAAGTTGTCCAATGTTTTGAGTGAAAGCAAGGGCAACGGGACGGTGTCAGTACGACTGGCCGACGAGAAGGT
CGTCACTGTTCCCAGCGTCCAAGTGGATCTGGCCGTCAAATTTGAAGAATTTGACAGCCTCGAACAGCTCACTGTTCTCGACATGGATCCATACGATATG
ATCCTGGGCATGGCCTGGCTTGAGGAGCACGCACCCTAGATCGACTGGCGAAGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGCCCGACGGAGCATTGG
TGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCAAGGGTTGCCGGGGGACCAAAGCGTCCGGCAGACGCTTGGGAGTCGTCGACGTATATGA
CGACTCCGAGGATGTTTTGATGGTGGCAGCGCCCAGAGGAGGCGCTGGCCAAGTGAGTAGCTTAGGTCCACAAGCGGGTAACTTAGTTCCGCAGACAGCT
GTAGCTGTCACGAACTTTGACGATAGCGTGTTCCTTGTGGGTAACAGAGTTCCACACACGGTCGCCCGGACCTTAACGGAAGAGGAAGACATCTTCCCGT
GTGGGTAACATAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGTGTTGAGCACGCTTCCTGTGTGGGTACCACAGTATCACACGAGGCCA
CGAGTGCCTCGGATGTCGGAGCGCCGACATCCCCAGACGTGGGTAGCAAAACTTCACGTCACGGTCGCCGTCGACGACGACGTCGCTTCAAGCGACTCGG
AGTCCAGTGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCGCATCTTCGATGGCGAGACCGGCTTACTCGTCAAGGCATCTGGTGTCCACTT
GGAGCCGTTGCCAGAGGCTGCAGAGATACTGAACCTCGAGGAAATGACGGTCAAGCCTTTCCTGGTCAACCTCAAGGCTGGAAAGGTTACCGAAATGGTG
CTCATGAGACCTGAGACCACTCGGCAGGAGCTGAACTCCTCCTCTGTTTTGGACGAGAACGTCCTGGAAGACCTGAACAAGCAGCATCAGACGCGCTTGA
ATTCTGAGATCCTAAAGAATCCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCAGACGTGGTGAACAAACACCCACGGACCCAGCTTCAACCAG
ATCGAGGCGTACGGCATTAGATTGATCTCGTGCCAGGCACAAAGTATTGTGTCACGAGGTAATGGCCTCTTCCGCGCGAGCTGTGCGAGGTCATTGTTGC
CTTCTTCGCTGCGATAGCGAAGGCATGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGACGCCAACCTTCTGCGTTCGGAGCCCGAACGGAAAGTGCCGT
CTAGCTCATGCTTAAAATAAACTGAACAACGCGATGGTGCCGGCTTAAACACCAATCCCACGAAAGGACGTGTTGTTAGACAACTTGGCAGGAAGCGTAC
AGTAAAGTGCGCTGGATTTGGTAGACGGATACTACCAGATCTTGATGCGCGAGAGCGACATCCCACTCACTGCGGTGGGCACTCCATGCGGCATGCTTTG
GGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAGCACCCCGGCGACATTCAGTAGCCTCGTGACGCAATTGTTCAGGCCACTGCGCGCCTTTGTACAGACG
TACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGACGCAAGACGGCCATGGAGGTGCATCTGGGCACATCCGTCGAGTGTTGGACGTGATGCGACC
GAGCAGGCTCGACGTCAACATCGACAAGTGCCTCTTCGCGTCATCAGAGATTAAGGCTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCA
GATAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATTCCAGAAGGATCTTCGAAAAAGGTTGGGCTTGGCCAACTACCTTCCCAAGTACAGAGCAG
GGTATGCGGGCTTGACTAAGCCCTTGTCGGGCCTCCTTCAGAAGGACGTCGACTGGCACTGGGAGCAAGAGCATCGAAATGCCTTTGACAGCATCAAGGC
CAGTCACCAAAATGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCGTCCGATTACGCCATCGGATGTGTATTGCTG
CAGGTCGACACGGCTGGACATGAGCGAGTCATCTCGTTACAGTCCAGGCGAGCTCCTGGCAATGACATATGCCCTTGTGAAGTTTCGTGTTCACCTTCTA
GGCTCCCGGCTCTTCGTGTTCTACACAGACCACGCATTTTTGAGGACGGCGACAAATTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCT
TCGCGGAGTACAACTTCCGCGTCGAGTACAAGCCGGGCAAACTCAACGTGATTGCGGACGCCCTCTATCGGCGTCCTGACTACAAGTTGGCCCACATCAC
ACGGGTGACAACGGATCTATATGAGCGGATATGCATGGCGTATCGAGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTCACGGCAGGAACGAGCGCG
AAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAGAGATGGCCTCCTCTATTACAGGGTGGAACCCTATGACCCTCCAC
GGGTGGTCGTACCCAACGACTAGGATCTGAAGTTCGACATCCTCGCGGAAGCGCACGATACGCCATCCAGCGGCCACTTGGGTCGCGAGAAGACCGACAG
CACCGGAATTTTGGTGTTCGTGTGTCAGCTGAGCAAGATGTACCATCTTGCTCCAGTTCCCGTTACCGCTACGGGCGAACAAACCGCAAGGTTGTTTGTC
GATAGCGTGTTCCGCTATCCCAGTCTCCCGGAGACGATTGTCTCGGATCGAGACCCGCGGTTCACGGCTGCGTTTTGGAAAACGCTGTTTCCTTTCCTGG
GAACTCGTCTGCAGATGTCCACTGCGGACCACCCGCAGACAGACGGCCAGACAGAGCGCATCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGC
GACAGCCCCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACTACGCGGTGCACGCGTCCACGGGGTTCACGCCGCTCTACTTGAAC
GGCTTCCGTCACCCCAGAGTGCCTCTCACTCCTCGAGACACTAACCCCTCTATTCTAAGTGGGGGAGAGGCTCTGAAAGCTCTTTCCTCCCAGGTCTCAG
CTGTGAGACCAGTTTCGCTGCGGAAACAAGTGGAATCCGTTTTGGATACCAAGCTGAGCATTGTCAGCAGGGTCCGCGATGCAATGGCGGCGGCCCAGGA
TAGACAAAAGGAGTACTCCGGCAAACATGGAAGAGGAAATTTAAGTGTATTTATAGTGGGGGACTTAGTGATACTAGCCACGAGGAACCTACCTCTTGAC
ACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCATTTGCAGTCCTGGCCAGACATGGTACGTCGTACACCATCGCCCTCCCTA
AGTCAATGACGGCGCACCCGACGTTCTATTTTGGACGTCTTAAGCGGTACTTTGATCCGCAGGGGGTTGCTGACTCGCAGACCCACCTTGGCCCAGCTCC
TCGAAGCGAGGGCCGGCCACAGACGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCTGAGCGGCAAGGTTGCGGTCAAGACTGTACGCAGGAG
GGTCTCCATACGAACGGGCCCCGGAGACATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTTCGTCTGGTAGTGCGTCGAAGGCGGCTC
CGGACGTGACAACAGACGATCCGTCGGATCATGCGGAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGATGCAGGATCGCGAACT
AACGCCCCAACAGGACCAGGCGGGCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGTCTGGGCGGCAGTATCACCGCCAGTCCCAAGGCCAAGTGCGAT
CTCAAGCACGAGAACACGTTGACGGAGGCGGTCAACCTCAAGGCACCCGCAGGAGAAGGACTCGGACGAGAGTGGCGTTCGGGAGGCCCCAAGGACTCGT
ACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAGTGAAGAAGCCACTTCCACGTGGAACGGATCCTCCAGGAGCAACGGCGTCGCGGTAAGCGACA
GCTCCTCGTGAAGTGGAGGGGCCATGCCACTACGAGAACTCGTCAATCAGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCG
GCAGCTTCATAAGTAGTCCGGGGCTTCTTTCCGAACGGTGTACGGACGTTGAAGACACTCCGTACCCGCGCTTATCATGAGCGCTAGAAGCCGCGCGCTT
CAAGATGTCCCTTGGCAGCATGCGCTTGCTGACCATGTGGGCAAACCGAACACGAAGATCACGCTGGTCCAGGATGCGGGACAGCAGCTGATCTTCATGG
AGTTCCCGTAACTCCGTGGGTGAGTACTTGAGAGACTCCACCCAAGCCCAGAACATGTCCTCGCGAGATCGCCAGGTGGGGCAGTTCTCGGGCAGAACCC
AGATGTACCCCCAAAAAGGATAGAGACCACCCCGGCTCTCGGGCTTCTTACGACACGTAGTGAAGGCCTTAAGAGGGATGCAGTGTGGCGCGAGAAGCAC
ACACCGAGCCGCCTCCAAGTTGTCAACAAACAACTGTTCCTTCTAGGCAAGAGCACGTTCGTAAATGCCCCTATAGGTGTGGCCGCCCACAAGGCCACGA
GGAGCGACGAGAAGCTCCAGGAAGAGGTCAGCCCAGAGCTCTCCTTGGGAGGCCAATACCCTCTTGCGTTGATGGCAGCTCCCTGGCTGACGGGTGCCAC
CGCCGAACTTCCACGCGAACGCTGGGCAGCTTGGAAGTCCTCCTGCTTCTAGTCGAGGTCATTAGTGATCTCTCGGGGCTCCGAAATAGCACCCTCCTCC
TCATCCTATTTCTTCTCCTTCTCGTCCTCTTCACCCGAGGAGTCGAAGAGGCCCCGATGAGGGTACCGAGTCTCCTTCTCTGCGGAGTGGAGACTTCGAA
GCCAAACGCTTCTTAGAGGGCTTGGCGCCTTCGGCTTTCGCGGCCTTAGCACGAGCAAGTTTCTCGGCAAGCGAGAGACGGTTGCCAGGCTTACCCTCCT
CATCGCCACCAGCTTTGGGAGTGCCCTTAGCCTTGACGACCGGACTCTCAAGTGCACATACGTCCTGGGACTGTGATCACCTTGATCACTAGCGAGCGAC
TACACGCTGTCGTCTTTGTGTTCGCTGGGCACTGGGCTGTGCCCTCCCGCAGAGTCCGCAGGAGCATCGTGCGTGCTCTCGGACACGGCTTCGTCCTCAC
TGCCAGAGTCGAACTGACGTTCAGCGAACCGAGGGTTCGGACGGTTGTCTGGGGAGGCCGAGGGCGACGGACTGCGGCGCTTGCTCGTTCTCTTGGCCAC
AGCCGCGTCACCCGTTGAGCCGATCTCTTCGGAGACCACTTTAGTAGCCTCCTGGAGTGCCGAGCCTTTGCCGTGAGAATTAG